EMAIL THIS PAGE TO A FRIEND

EFR3B

EFR3 homolog B (S. cerevisiae)

Synonyms: KIAA0953
UniProtKB ID: Q9Y2G0, B7WPL8, Q86XU6
Gene ID:
Mouse(668212) EFR3 homolog B (S. cerevisiae)
Rat(313928) EFR3 homolog B (S. cerevisiae)
sheep(101108899) EFR3 homolog B (S. cerevisiae)
domestic guinea pig(100720537) EFR3 homolog B (S. cerevisiae)
naked mole-rat(101717711) EFR3 homolog B (S. cerevisiae)
chicken(422012) EFR3 homolog B (S. cerevisiae)
cow(517590) EFR3 homolog B (S. cerevisiae)
domestic cat(101087472) EFR3 homolog B (S. cerevisiae)
dog(475686) EFR3 homolog B (S. cerevisiae)
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001082483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001082483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001082483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014971 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_039733 Rosetta Predictions human pricing
XM_001066858 Rosetta Predictions rat pricing
XM_233942 Rosetta Predictions rat pricing
NM_001082483 Rosetta Predictions mouse pricing
XM_001004466 Rosetta Predictions mouse pricing
XM_001004470 Rosetta Predictions mouse pricing
XM_001004475 Rosetta Predictions mouse pricing
XM_001004477 Rosetta Predictions mouse pricing
XM_001004478 Rosetta Predictions mouse pricing
XM_001004480 Rosetta Predictions mouse pricing
XM_001004484 Rosetta Predictions mouse pricing
XM_001004487 Rosetta Predictions mouse pricing
XM_001004490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_039733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251214 predicted 1375
2 SASI_Hs01_00251215 predicted 1976
3 SASI_Hs01_00251216 predicted 2048
4 SASI_Hs01_00251217 predicted 946
5 SASI_Hs01_00251218 predicted 992
6 SASI_Hs01_00251219 predicted 994
7 SASI_Hs01_00251220 predicted 2238
8 SASI_Hs01_00251221 predicted 762
9 SASI_Hs01_00251222 predicted 946
10 SASI_Hs01_00251223 predicted 2345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318909 predicted 840
2 SASI_Rn02_00318910 predicted 1535
3 SASI_Rn02_00318911 predicted 258
4 SASI_Rn02_00318912 predicted 2181
5 SASI_Rn02_00318913 predicted 909
6 SASI_Rn02_00318914 predicted 2196
7 SASI_Rn02_00318915 predicted 850
8 SASI_Rn02_00318916 predicted 2033
9 SASI_Rn02_00318917 predicted 308
10 SASI_Rn02_00318918 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388130 predicted 2422
2 SASI_Rn02_00388131 predicted 1856
3 SASI_Rn02_00388132 predicted 573
4 SASI_Rn02_00388133 predicted 2495
5 SASI_Rn02_00388134 predicted 1888
6 SASI_Rn02_00388135 predicted 2513
7 SASI_Rn02_00388136 predicted 2351
8 SASI_Rn02_00388137 predicted 624
9 SASI_Rn02_00388138 predicted 2172
10 SASI_Rn02_00388139 predicted 2576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299262 predicted 1636
2 SASI_Mm02_00299263 predicted 2290
3 SASI_Mm02_00299264 predicted 2005
4 SASI_Mm02_00299265 predicted 1007
5 SASI_Mm02_00299266 predicted 2278
6 SASI_Mm02_00299267 predicted 2634
7 SASI_Mm02_00299268 predicted 404
8 SASI_Mm02_00299269 predicted 935
9 SASI_Mm02_00299270 predicted 2502
10 SASI_Mm02_00299271 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262533 predicted 398
2 SASI_Mm01_00262534 predicted 364
3 SASI_Mm01_00262535 predicted 295
4 SASI_Mm01_00262536 predicted 321
5 SASI_Mm01_00262537 predicted 240
6 SASI_Mm01_00262538 predicted 420
7 SASI_Mm01_00262539 predicted 247
8 SASI_Mm01_00262540 predicted 246
9 SASI_Mm01_00262541 predicted 394
10 SASI_Mm01_00262542 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220707 predicted 1644
2 SASI_Mm01_00220708 predicted 2290
3 SASI_Mm01_00220709 predicted 1012
4 SASI_Mm01_00220710 predicted 2273
5 SASI_Mm01_00220711 predicted 2630
6 SASI_Mm01_00220712 predicted 405
7 SASI_Mm01_00220713 predicted 1792
8 SASI_Mm01_00220714 predicted 947
9 SASI_Mm01_00220715 predicted 2497
10 SASI_Mm01_00220716 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217154 predicted 1841
2 SASI_Mm01_00217155 predicted 1420
3 SASI_Mm01_00217156 predicted 1930
4 SASI_Mm01_00217157 predicted 1533
5 SASI_Mm01_00217158 predicted 2130
6 SASI_Mm01_00217159 predicted 2013
7 SASI_Mm01_00217160 predicted 1552
8 SASI_Mm01_00217161 predicted 1896
9 SASI_Mm01_00217162 predicted 2042
10 SASI_Mm01_00217163 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221418 predicted 1380
2 SASI_Mm01_00221419 predicted 534
3 SASI_Mm01_00221420 predicted 1106
4 SASI_Mm01_00221421 predicted 1340
5 SASI_Mm01_00221422 predicted 540
6 SASI_Mm01_00221423 predicted 994
7 SASI_Mm01_00221424 predicted 522
8 SASI_Mm01_00221425 predicted 883
9 SASI_Mm01_00221426 predicted 746
10 SASI_Mm01_00221427 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260202 predicted 788
2 SASI_Mm01_00260203 predicted 482
3 SASI_Mm01_00260204 predicted 508
4 SASI_Mm01_00260205 predicted 1136
5 SASI_Mm01_00260206 predicted 856
6 SASI_Mm01_00260207 predicted 1595
7 SASI_Mm01_00260208 predicted 1120
8 SASI_Mm01_00260209 predicted 1489
9 SASI_Mm01_00260210 predicted 632
10 SASI_Mm01_00260211 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248793 predicted 995
2 SASI_Mm01_00248794 predicted 687
3 SASI_Mm01_00248795 predicted 718
4 SASI_Mm01_00248796 predicted 1343
5 SASI_Mm01_00248797 predicted 1055
6 SASI_Mm01_00248798 predicted 1801
7 SASI_Mm01_00248799 predicted 1323
8 SASI_Mm01_00248800 predicted 1692
9 SASI_Mm01_00248801 predicted 831
10 SASI_Mm01_00248802 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233171 predicted 1580
2 SASI_Mm01_00233172 predicted 2231
3 SASI_Mm01_00233173 predicted 943
4 SASI_Mm01_00233174 predicted 2218
5 SASI_Mm01_00233175 predicted 2582
6 SASI_Mm01_00233176 predicted 344
7 SASI_Mm01_00233177 predicted 1717
8 SASI_Mm01_00233178 predicted 876
9 SASI_Mm01_00233179 predicted 2444
10 SASI_Mm01_00233180 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255204 predicted 1640
2 SASI_Mm01_00255205 predicted 2167
3 SASI_Mm01_00255206 predicted 1009
4 SASI_Mm01_00255207 predicted 2146
5 SASI_Mm01_00255208 predicted 2515
6 SASI_Mm01_00255209 predicted 410
7 SASI_Mm01_00255210 predicted 1785
8 SASI_Mm01_00255211 predicted 941
9 SASI_Mm01_00255212 predicted 2371
10 SASI_Mm01_00255213 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229859 predicted 1639
2 SASI_Mm01_00229860 predicted 2290
3 SASI_Mm01_00229861 predicted 1008
4 SASI_Mm01_00229862 predicted 2279
5 SASI_Mm01_00229863 predicted 2637
6 SASI_Mm01_00229864 predicted 411
7 SASI_Mm01_00229865 predicted 1786
8 SASI_Mm01_00229866 predicted 945
9 SASI_Mm01_00229867 predicted 2500
10 SASI_Mm01_00229868 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082483
EFR3B MISSION shRNA Bacterial Glycerol Stock
EFR3 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-1151s21c1
Sequence:CCGGCTATCGGAAGCTGCAATTATCCTCGAGGATAATTGCAGCTTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082483.1-6208s21c1
Sequence:CCGGGTCTGGCACATGGAGTATAAACTCGAGTTTATACTCCATGTGCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-693s21c1
Sequence:CCGGTCCGCATGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-955s21c1
Sequence:CCGGCGCCATCAAGCCCGTTCTTATCTCGAGATAAGAACGGGCTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-1594s21c1
Sequence:CCGGCCTCATGGAGGACGCAGAAATCTCGAGATTTCTGCGTCCTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082483
EFR3B MISSION shRNA shRNA Plasmid DNA
EFR3 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-1151s21c1
Sequence:CCGGCTATCGGAAGCTGCAATTATCCTCGAGGATAATTGCAGCTTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082483.1-6208s21c1
Sequence:CCGGGTCTGGCACATGGAGTATAAACTCGAGTTTATACTCCATGTGCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-693s21c1
Sequence:CCGGTCCGCATGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-955s21c1
Sequence:CCGGCGCCATCAAGCCCGTTCTTATCTCGAGATAAGAACGGGCTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-1594s21c1
Sequence:CCGGCCTCATGGAGGACGCAGAAATCTCGAGATTTCTGCGTCCTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082483
EFR3B MISSION shRNA Lentiviral Transduction Particles
EFR3 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-1151s21c1
Sequence:CCGGCTATCGGAAGCTGCAATTATCCTCGAGGATAATTGCAGCTTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082483.1-6208s21c1
Sequence:CCGGGTCTGGCACATGGAGTATAAACTCGAGTTTATACTCCATGTGCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-693s21c1
Sequence:CCGGTCCGCATGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-955s21c1
Sequence:CCGGCGCCATCAAGCCCGTTCTTATCTCGAGATAAGAACGGGCTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082483.1-1594s21c1
Sequence:CCGGCCTCATGGAGGACGCAGAAATCTCGAGATTTCTGCGTCCTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014971
VALIDATED
EFR3B MISSION shRNA Bacterial Glycerol Stock
EFR3 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_014971.1-1609s21c1
Sequence:CCGGATGCAGAAATTCGACTCTTTGCTCGAGCAAAGAGTCGAATTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014971.1-6623s21c1
Sequence:CCGGTTAGGTAGACACTAGGTTTAACTCGAGTTAAACCTAGTGTCTACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-1478s21c1
Sequence:CCGGGAACCGTCTGACCCAGATTATCTCGAGATAATCTGGGTCAGACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014971.1-3684s21c1
Sequence:CCGGAGGATCTAACACCTAATATTGCTCGAGCAATATTAGGTGTTAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-2255s21c1
Sequence:CCGGGACAGATGAGGATCGTTTATCCTCGAGGATAAACGATCCTCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-730s21c1
Sequence:CCGGTGGTGAGGAAGACGGTGAATGCTCGAGCATTCACCGTCTTCCTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-697s21c1
Sequence:CCGGTTCGAATGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014971.1-773s21c1
Sequence:CCGGGGACCCACAGCACATGGATAACTCGAGTTATCCATGTGCTGTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-616s21c1
Sequence:CCGGACCGGAGCTATGACTTCTTTGCTCGAGCAAAGAAGTCATAGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014971
VALIDATED
EFR3B MISSION shRNA shRNA Plasmid DNA
EFR3 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_014971.1-1609s21c1
Sequence:CCGGATGCAGAAATTCGACTCTTTGCTCGAGCAAAGAGTCGAATTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014971.1-6623s21c1
Sequence:CCGGTTAGGTAGACACTAGGTTTAACTCGAGTTAAACCTAGTGTCTACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-1478s21c1
Sequence:CCGGGAACCGTCTGACCCAGATTATCTCGAGATAATCTGGGTCAGACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014971.1-3684s21c1
Sequence:CCGGAGGATCTAACACCTAATATTGCTCGAGCAATATTAGGTGTTAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-2255s21c1
Sequence:CCGGGACAGATGAGGATCGTTTATCCTCGAGGATAAACGATCCTCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-730s21c1
Sequence:CCGGTGGTGAGGAAGACGGTGAATGCTCGAGCATTCACCGTCTTCCTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-697s21c1
Sequence:CCGGTTCGAATGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014971.1-773s21c1
Sequence:CCGGGGACCCACAGCACATGGATAACTCGAGTTATCCATGTGCTGTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-616s21c1
Sequence:CCGGACCGGAGCTATGACTTCTTTGCTCGAGCAAAGAAGTCATAGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014971
VALIDATED
EFR3B MISSION shRNA Lentiviral Transduction Particles
EFR3 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_014971.1-1609s21c1
Sequence:CCGGATGCAGAAATTCGACTCTTTGCTCGAGCAAAGAGTCGAATTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014971.1-6623s21c1
Sequence:CCGGTTAGGTAGACACTAGGTTTAACTCGAGTTAAACCTAGTGTCTACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-1478s21c1
Sequence:CCGGGAACCGTCTGACCCAGATTATCTCGAGATAATCTGGGTCAGACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014971.1-3684s21c1
Sequence:CCGGAGGATCTAACACCTAATATTGCTCGAGCAATATTAGGTGTTAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-2255s21c1
Sequence:CCGGGACAGATGAGGATCGTTTATCCTCGAGGATAAACGATCCTCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-730s21c1
Sequence:CCGGTGGTGAGGAAGACGGTGAATGCTCGAGCATTCACCGTCTTCCTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-697s21c1
Sequence:CCGGTTCGAATGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014971.1-773s21c1
Sequence:CCGGGGACCCACAGCACATGGATAACTCGAGTTATCCATGTGCTGTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014971.1-616s21c1
Sequence:CCGGACCGGAGCTATGACTTCTTTGCTCGAGCAAAGAAGTCATAGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks