EMAIL THIS PAGE TO A FRIEND

EFS

embryonal Fyn-associated substrate

120 Gene Product Result for
Synonyms: CAS3 CASS3 EFS1 EFS2 HEFS SIN
UniProtKB ID: O43281, B2RAJ7, O43282
Gene ID:
Human(10278) Summary: The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
Mouse(13644) embryonal Fyn-associated substrate
Rat(290212) embryonal Fyn-associated substrate
Thale Cress(844066) histone-lysine N-methyltransferase ASHH2
cow(508559) embryonal Fyn-associated substrate
domestic cat(101096072) embryonal Fyn-associated substrate
dog(480251) embryonal Fyn-associated substrate
naked mole-rat(101713313) embryonal Fyn-associated substrate
domestic guinea pig(100727975) embryonal Fyn-associated substrate
sheep(101120836) embryonal Fyn-associated substrate
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005864 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005864 Rosetta Predictions human pricing
NM_032459 Rosetta Predictions human pricing
NM_001106033 Rosetta Predictions rat pricing
NM_010112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340428 predicted 1910
2 SASI_Hs01_00141812 predicted 2736
3 SASI_Hs01_00141814 predicted 2747
4 SASI_Hs01_00141815 predicted 2730
5 SASI_Hs02_00340429 predicted 2045
6 SASI_Hs01_00141816 predicted 2042
7 SASI_Hs01_00141817 predicted 2747
8 SASI_Hs01_00141818 predicted 2716
9 SASI_Hs01_00141819 predicted 1152
10 SASI_Hs01_00141821 predicted 1144
11 SASI_Hs01_00141813 predicted 2214
12 SASI_Hs01_00141820 predicted 2220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359897 predicted 1636
2 SASI_Hs01_00193902 predicted 2452
3 SASI_Hs01_00193904 predicted 2468
4 SASI_Hs01_00193905 predicted 2449
5 SASI_Hs02_00359898 predicted 1767
6 SASI_Hs01_00193907 predicted 1763
7 SASI_Hs01_00193908 predicted 2471
8 SASI_Hs01_00193909 predicted 2441
9 SASI_Hs01_00193910 predicted 876
10 SASI_Hs02_00359899 predicted 872
11 SASI_Hs01_00193903 predicted 1941
12 SASI_Hs01_00193906 predicted 1011
13 SASI_Hs01_00193911 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214962 predicted 2099
2 SASI_Rn02_00214963 predicted 906
3 SASI_Rn02_00214964 predicted 750
4 SASI_Rn02_00214965 predicted 704
5 SASI_Rn02_00214966 predicted 1492
6 SASI_Rn02_00214967 predicted 523
7 SASI_Rn02_00214968 predicted 1521
8 SASI_Rn02_00214969 predicted 1525
9 SASI_Rn02_00214970 predicted 1645
10 SASI_Rn02_00214971 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145385 predicted 799
2 SASI_Mm01_00145386 predicted 1605
3 SASI_Mm01_00145387 predicted 1006
4 SASI_Mm01_00145388 predicted 620
5 SASI_Mm01_00145389 predicted 1200
6 SASI_Mm01_00145390 predicted 1614
7 SASI_Mm01_00145391 predicted 1790
8 SASI_Mm01_00145392 predicted 2105
9 SASI_Mm01_00145393 predicted 1203
10 SASI_Mm01_00145394 predicted 1621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005864
VALIDATED
EFS MISSION shRNA Bacterial Glycerol Stock
embryonal Fyn-associated substrate
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-1280s21c1
Sequence:CCGGACGAGCGTCAGCCTTACTCAACTCGAGTTGAGTAAGGCTGACGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-2822s21c1
Sequence:CCGGCATGGGTGTGCACCTTAATAACTCGAGTTATTAAGGTGCACACCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005864.2-1906s21c1
Sequence:CCGGTGCAGCTCCTGTACTTCTATGCTCGAGCATAGAAGTACAGGAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005864.2-1762s21c1
Sequence:CCGGACCTGAAGGGCATGGACAAAGCTCGAGCTTTGTCCATGCCCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-1738s21c1
Sequence:CCGGTGGCCGAGGAGTATGACTATGCTCGAGCATAGTCATACTCCTCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005864.2-1286s1c1
Sequence:CCGGGTCAGCCTTACTCAATTTGTACTCGAGTACAAATTGAGTAAGGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005864.2-2738s1c1
Sequence:CCGGGACATAAACTGTCCAGAGTTTCTCGAGAAACTCTGGACAGTTTATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005864.2-2978s1c1
Sequence:CCGGCAACAACTATTCACTGGACAACTCGAGTTGTCCAGTGAATAGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005864
VALIDATED
EFS MISSION shRNA shRNA Plasmid DNA
embryonal Fyn-associated substrate
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-1280s21c1
Sequence:CCGGACGAGCGTCAGCCTTACTCAACTCGAGTTGAGTAAGGCTGACGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-2822s21c1
Sequence:CCGGCATGGGTGTGCACCTTAATAACTCGAGTTATTAAGGTGCACACCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005864.2-1906s21c1
Sequence:CCGGTGCAGCTCCTGTACTTCTATGCTCGAGCATAGAAGTACAGGAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005864.2-1762s21c1
Sequence:CCGGACCTGAAGGGCATGGACAAAGCTCGAGCTTTGTCCATGCCCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-1738s21c1
Sequence:CCGGTGGCCGAGGAGTATGACTATGCTCGAGCATAGTCATACTCCTCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005864.2-1286s1c1
Sequence:CCGGGTCAGCCTTACTCAATTTGTACTCGAGTACAAATTGAGTAAGGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005864.2-2738s1c1
Sequence:CCGGGACATAAACTGTCCAGAGTTTCTCGAGAAACTCTGGACAGTTTATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005864.2-2978s1c1
Sequence:CCGGCAACAACTATTCACTGGACAACTCGAGTTGTCCAGTGAATAGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005864
VALIDATED
EFS MISSION shRNA Lentiviral Transduction Particles
embryonal Fyn-associated substrate
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-1280s21c1
Sequence:CCGGACGAGCGTCAGCCTTACTCAACTCGAGTTGAGTAAGGCTGACGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-2822s21c1
Sequence:CCGGCATGGGTGTGCACCTTAATAACTCGAGTTATTAAGGTGCACACCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005864.2-1906s21c1
Sequence:CCGGTGCAGCTCCTGTACTTCTATGCTCGAGCATAGAAGTACAGGAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005864.2-1762s21c1
Sequence:CCGGACCTGAAGGGCATGGACAAAGCTCGAGCTTTGTCCATGCCCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005864.2-1738s21c1
Sequence:CCGGTGGCCGAGGAGTATGACTATGCTCGAGCATAGTCATACTCCTCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005864.2-1286s1c1
Sequence:CCGGGTCAGCCTTACTCAATTTGTACTCGAGTACAAATTGAGTAAGGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005864.2-2738s1c1
Sequence:CCGGGACATAAACTGTCCAGAGTTTCTCGAGAAACTCTGGACAGTTTATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005864.2-2978s1c1
Sequence:CCGGCAACAACTATTCACTGGACAACTCGAGTTGTCCAGTGAATAGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010112
EFS MISSION shRNA Bacterial Glycerol Stock
embryonal Fyn-associated substrate
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010112.2-2490s1c1
Sequence:CCGGGCTGAAGATGACAATGTAATACTCGAGTATTACATTGTCATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-1553s1c1
Sequence:CCGGGCAGGCCCTCACAATGAATATCTCGAGATATTCATTGTGAGGGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-638s1c1
Sequence:CCGGGCTAACAGAGTGAAGCTCCTTCTCGAGAAGGAGCTTCACTCTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-622s1c1
Sequence:CCGGGCAGGGTATTGTCCCTGCTAACTCGAGTTAGCAGGGACAATACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-1166s1c1
Sequence:CCGGCCCGAGGAACTCCTGGCAAATCTCGAGATTTGCCAGGAGTTCCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010112
EFS MISSION shRNA shRNA Plasmid DNA
embryonal Fyn-associated substrate
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010112.2-2490s1c1
Sequence:CCGGGCTGAAGATGACAATGTAATACTCGAGTATTACATTGTCATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-1553s1c1
Sequence:CCGGGCAGGCCCTCACAATGAATATCTCGAGATATTCATTGTGAGGGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-638s1c1
Sequence:CCGGGCTAACAGAGTGAAGCTCCTTCTCGAGAAGGAGCTTCACTCTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-622s1c1
Sequence:CCGGGCAGGGTATTGTCCCTGCTAACTCGAGTTAGCAGGGACAATACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-1166s1c1
Sequence:CCGGCCCGAGGAACTCCTGGCAAATCTCGAGATTTGCCAGGAGTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010112
EFS MISSION shRNA Lentiviral Transduction Particles
embryonal Fyn-associated substrate
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010112.2-2490s1c1
Sequence:CCGGGCTGAAGATGACAATGTAATACTCGAGTATTACATTGTCATCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-1553s1c1
Sequence:CCGGGCAGGCCCTCACAATGAATATCTCGAGATATTCATTGTGAGGGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-638s1c1
Sequence:CCGGGCTAACAGAGTGAAGCTCCTTCTCGAGAAGGAGCTTCACTCTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-622s1c1
Sequence:CCGGGCAGGGTATTGTCCCTGCTAACTCGAGTTAGCAGGGACAATACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010112.2-1166s1c1
Sequence:CCGGCCCGAGGAACTCCTGGCAAATCTCGAGATTTGCCAGGAGTTCCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)