EMAIL THIS PAGE TO A FRIEND

EFTUD1

elongation factor Tu GTP binding domain containing 1

65 Gene Product Result for
Synonyms: FAM42A HsT19294 RIA1
UniProtKB ID: Q7Z2Z2, A6NKY5, B7Z6I0, Q9H8Z6
Gene ID:
Mouse(101592) elongation factor Tu GTP binding domain containing 1
Rat(308789) elongation factor Tu GTP binding domain containing 1
Zebrafish(568741) elongation factor Tu GTP binding domain containing 1
domestic cat(101088669) elongation factor Tu GTP binding domain containing 1
cow(527607) elongation factor Tu GTP binding domain containing 1
Horse(100052899) elongation factor Tu GTP binding domain containing 1
dog(479061) elongation factor Tu GTP binding domain containing 1
chicken(415467) elongation factor Tu GTP binding domain containing 1
sheep(101112350) elongation factor Tu GTP binding domain containing 1
domestic guinea pig(100729113) elongation factor Tu GTP binding domain containing 1
naked mole-rat(101697880) elongation factor Tu GTP binding domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024580 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040610 Rosetta Predictions human pricing
NM_024580 Rosetta Predictions human pricing
NM_001107534 Rosetta Predictions rat pricing
NM_175317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050810 predicted 3008
2 SASI_Hs01_00050811 predicted 3272
3 SASI_Hs02_00309004 predicted 2161
4 SASI_Hs01_00050815 predicted 3028
5 SASI_Hs02_00309005 predicted 1265
6 SASI_Hs02_00309006 predicted 2984
7 SASI_Hs01_00050817 predicted 2324
8 SASI_Hs01_00050818 predicted 2925
9 SASI_Hs01_00050819 predicted 3163
10 SASI_Hs02_00309007 predicted 2955
11 SASI_Hs01_00050812 predicted 2698
12 SASI_Hs01_00050813 predicted 2308
13 SASI_Hs01_00050814 predicted 2780
14 SASI_Hs01_00050816 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118906 predicted 3154
2 SASI_Hs01_00118907 predicted 3425
3 SASI_Hs02_00356903 predicted 2311
4 SASI_Hs01_00118911 predicted 3181
5 SASI_Hs02_00356904 predicted 1421
6 SASI_Hs02_00356905 predicted 3146
7 SASI_Hs01_00118913 predicted 2469
8 SASI_Hs01_00118914 predicted 3078
9 SASI_Hs01_00118915 predicted 3316
10 SASI_Hs02_00356906 predicted 3110
11 SASI_Hs01_00118908 predicted 2812
12 SASI_Hs01_00118909 predicted 2419
13 SASI_Hs01_00118910 predicted 2896
14 SASI_Hs01_00118912 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229775 predicted 324
2 SASI_Rn02_00229776 predicted 2290
3 SASI_Rn02_00229777 predicted 2877
4 SASI_Rn02_00229778 predicted 1275
5 SASI_Rn02_00229779 predicted 266
6 SASI_Rn02_00229780 predicted 972
7 SASI_Rn02_00229781 predicted 3331
8 SASI_Rn02_00229782 predicted 1516
9 SASI_Rn02_00229783 predicted 2500
10 SASI_Rn02_00229784 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035576 predicted 2282
2 SASI_Mm01_00035577 predicted 309
3 SASI_Mm01_00035578 predicted 2946
4 SASI_Mm01_00035580 predicted 1900
5 SASI_Mm01_00035581 predicted 1265
6 SASI_Mm01_00035582 predicted 1956
7 SASI_Mm01_00035583 predicted 2056
8 SASI_Mm01_00035584 predicted 744
9 SASI_Mm02_00346101 predicted 374
10 SASI_Mm01_00035585 predicted 959
11 SASI_Mm01_00035579 predicted 1275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024580
VALIDATED
EFTUD1 MISSION shRNA Bacterial Glycerol Stock
elongation factor Tu GTP binding domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024580.3-504s1c1
Sequence:CCGGCGCTTGATAGTGGAACTGAAACTCGAGTTTCAGTTCCACTATCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024580.3-2202s1c1
Sequence:CCGGGCAGTCATACACCAAATGAAACTCGAGTTTCATTTGGTGTATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024580.5-1126s21c1
Sequence:CCGGAGTGACTTCTTTAGGATTAAACTCGAGTTTAATCCTAAAGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-2219s21c1
Sequence:CCGGAGTGTATCTGAACCTATTATTCTCGAGAATAATAGGTTCAGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-2377s21c1
Sequence:CCGGTGACGGGCTAATCACCATAACCTCGAGGTTATGGTGATTAGCCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-1164s21c1
Sequence:CCGGCACGACATTCAGACCCTAAAGCTCGAGCTTTAGGGTCTGAATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024580.5-2477s21c1
Sequence:CCGGAGTGATTTGATTCGTTCTATGCTCGAGCATAGAACGAATCAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024580
VALIDATED
EFTUD1 MISSION shRNA shRNA Plasmid DNA
elongation factor Tu GTP binding domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024580.3-504s1c1
Sequence:CCGGCGCTTGATAGTGGAACTGAAACTCGAGTTTCAGTTCCACTATCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024580.3-2202s1c1
Sequence:CCGGGCAGTCATACACCAAATGAAACTCGAGTTTCATTTGGTGTATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024580.5-1126s21c1
Sequence:CCGGAGTGACTTCTTTAGGATTAAACTCGAGTTTAATCCTAAAGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-2219s21c1
Sequence:CCGGAGTGTATCTGAACCTATTATTCTCGAGAATAATAGGTTCAGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-2377s21c1
Sequence:CCGGTGACGGGCTAATCACCATAACCTCGAGGTTATGGTGATTAGCCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-1164s21c1
Sequence:CCGGCACGACATTCAGACCCTAAAGCTCGAGCTTTAGGGTCTGAATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024580.5-2477s21c1
Sequence:CCGGAGTGATTTGATTCGTTCTATGCTCGAGCATAGAACGAATCAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024580
VALIDATED
EFTUD1 MISSION shRNA Lentiviral Transduction Particles
elongation factor Tu GTP binding domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024580.3-504s1c1
Sequence:CCGGCGCTTGATAGTGGAACTGAAACTCGAGTTTCAGTTCCACTATCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024580.3-2202s1c1
Sequence:CCGGGCAGTCATACACCAAATGAAACTCGAGTTTCATTTGGTGTATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024580.5-1126s21c1
Sequence:CCGGAGTGACTTCTTTAGGATTAAACTCGAGTTTAATCCTAAAGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-2219s21c1
Sequence:CCGGAGTGTATCTGAACCTATTATTCTCGAGAATAATAGGTTCAGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-2377s21c1
Sequence:CCGGTGACGGGCTAATCACCATAACCTCGAGGTTATGGTGATTAGCCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024580.5-1164s21c1
Sequence:CCGGCACGACATTCAGACCCTAAAGCTCGAGCTTTAGGGTCTGAATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024580.5-2477s21c1
Sequence:CCGGAGTGATTTGATTCGTTCTATGCTCGAGCATAGAACGAATCAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175317
VALIDATED
EFTUD1 MISSION shRNA Bacterial Glycerol Stock
elongation factor Tu GTP binding domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-2836s1c1
Sequence:CCGGCCTGTCACGTTGGAGATGAAACTCGAGTTTCATCTCCAACGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-500s1c1
Sequence:CCGGCCGCCTGATAGTGGAACTAAACTCGAGTTTAGTTCCACTATCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175317.2-2424s1c1
Sequence:CCGGGCCATTCATCAGAAGACCCAACTCGAGTTGGGTCTTCTGATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175317.2-1047s1c1
Sequence:CCGGGCACGACATTCAGACCCTAAACTCGAGTTTAGGGTCTGAATGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175317.2-1275s1c1
Sequence:CCGGGCTCCAGTTATTATCTTTGTTCTCGAGAACAAAGATAATAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175317.2-2951s1c1
Sequence:CCGGGCAGCTAATTGCTACCATGAACTCGAGTTCATGGTAGCAATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-162s1c1
Sequence:CCGGGATTGTCTTATATCCAGTAATCTCGAGATTACTGGATATAAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-2511s1c1
Sequence:CCGGGTTGACCAGATCTGGTCATTTCTCGAGAAATGACCAGATCTGGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175317
VALIDATED
EFTUD1 MISSION shRNA shRNA Plasmid DNA
elongation factor Tu GTP binding domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-2836s1c1
Sequence:CCGGCCTGTCACGTTGGAGATGAAACTCGAGTTTCATCTCCAACGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-500s1c1
Sequence:CCGGCCGCCTGATAGTGGAACTAAACTCGAGTTTAGTTCCACTATCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175317.2-2424s1c1
Sequence:CCGGGCCATTCATCAGAAGACCCAACTCGAGTTGGGTCTTCTGATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175317.2-1047s1c1
Sequence:CCGGGCACGACATTCAGACCCTAAACTCGAGTTTAGGGTCTGAATGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175317.2-1275s1c1
Sequence:CCGGGCTCCAGTTATTATCTTTGTTCTCGAGAACAAAGATAATAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175317.2-2951s1c1
Sequence:CCGGGCAGCTAATTGCTACCATGAACTCGAGTTCATGGTAGCAATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-162s1c1
Sequence:CCGGGATTGTCTTATATCCAGTAATCTCGAGATTACTGGATATAAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-2511s1c1
Sequence:CCGGGTTGACCAGATCTGGTCATTTCTCGAGAAATGACCAGATCTGGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175317
VALIDATED
EFTUD1 MISSION shRNA Lentiviral Transduction Particles
elongation factor Tu GTP binding domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-2836s1c1
Sequence:CCGGCCTGTCACGTTGGAGATGAAACTCGAGTTTCATCTCCAACGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-500s1c1
Sequence:CCGGCCGCCTGATAGTGGAACTAAACTCGAGTTTAGTTCCACTATCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175317.2-2424s1c1
Sequence:CCGGGCCATTCATCAGAAGACCCAACTCGAGTTGGGTCTTCTGATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175317.2-1047s1c1
Sequence:CCGGGCACGACATTCAGACCCTAAACTCGAGTTTAGGGTCTGAATGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175317.2-1275s1c1
Sequence:CCGGGCTCCAGTTATTATCTTTGTTCTCGAGAACAAAGATAATAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175317.2-2951s1c1
Sequence:CCGGGCAGCTAATTGCTACCATGAACTCGAGTTCATGGTAGCAATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-162s1c1
Sequence:CCGGGATTGTCTTATATCCAGTAATCTCGAGATTACTGGATATAAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175317.2-2511s1c1
Sequence:CCGGGTTGACCAGATCTGGTCATTTCTCGAGAAATGACCAGATCTGGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks