EMAIL THIS PAGE TO A FRIEND

EFTUD2

elongation factor Tu GTP binding domain containing 2

81 Gene Product Result for
Synonyms: MFDGA MFDM SNRNP116 Snrp116 Snu114 U5-116KD
UniProtKB ID: Q15029, B4DK30, D3DX58, Q9BUR0
Gene ID:
Human(9343) Summary: This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(20624) elongation factor Tu GTP binding domain containing 2
Rat(287739) elongation factor Tu GTP binding domain containing 2
Zebrafish(393480) elongation factor Tu GTP binding domain containing 2
cow(509425) elongation factor Tu GTP binding domain containing 2
Horse(100050574) elongation factor Tu GTP binding domain containing 2
domestic cat(101081014) elongation factor Tu GTP binding domain containing 2
dog(490935) elongation factor Tu GTP binding domain containing 2
chicken(428281) elongation factor Tu GTP binding domain containing 2
naked mole-rat(101709324) elongation factor Tu GTP binding domain containing 2
domestic guinea pig(100720683) elongation factor Tu GTP binding domain containing 2
sheep(101116744) elongation factor Tu GTP binding domain containing 2
Domestic Rabbit(100341208) elongation factor Tu GTP binding domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA022021 Anti-EFTUD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701211 Anti-EFTUD2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB4503626 Anti-EFTUD2 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004247 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046301 MISSION® esiRNA esiRNA human EFTUD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004247 Rosetta Predictions human pricing
XM_001081526 Rosetta Predictions rat pricing
XM_213492 Rosetta Predictions rat pricing
NM_001109995 Rosetta Predictions mouse pricing
NM_011431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337183 predicted 1077
2 SASI_Hs01_00098907 predicted 2361
3 SASI_Hs01_00098909 predicted 1442
4 SASI_Hs01_00098910 predicted 524
5 SASI_Hs01_00098911 predicted 1125
6 SASI_Hs01_00098912 predicted 850
7 SASI_Hs01_00098913 predicted 527
8 SASI_Hs01_00098914 predicted 2511
9 SASI_Hs02_00337184 predicted 2049
10 SASI_Hs01_00098915 predicted 1681
11 SASI_Hs01_00098908 predicted 2546
12 SASI_Hs01_00098916 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372290 predicted 543
2 SASI_Rn02_00372291 predicted 1463
3 SASI_Rn02_00372292 predicted 229
4 SASI_Rn02_00372293 predicted 2535
5 SASI_Rn02_00372294 predicted 1392
6 SASI_Rn02_00372295 predicted 530
7 SASI_Rn02_00372296 predicted 2102
8 SASI_Rn02_00372297 predicted 369
9 SASI_Rn02_00372298 predicted 869
10 SASI_Rn02_00372299 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374636 predicted 549
2 SASI_Rn02_00374637 predicted 1467
3 SASI_Rn02_00374638 predicted 233
4 SASI_Rn02_00374639 predicted 2538
5 SASI_Rn02_00374640 predicted 1383
6 SASI_Rn02_00374641 predicted 531
7 SASI_Rn02_00374642 predicted 2105
8 SASI_Rn02_00374643 predicted 367
9 SASI_Rn02_00374644 predicted 867
10 SASI_Rn02_00374645 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304564 predicted 517
2 SASI_Mm02_00304565 predicted 2554
3 SASI_Mm02_00304566 predicted 574
4 SASI_Mm02_00304567 predicted 452
5 SASI_Mm02_00304568 predicted 1424
6 SASI_Mm02_00304569 predicted 947
7 SASI_Mm02_00304570 predicted 569
8 SASI_Mm02_00304571 predicted 1131
9 SASI_Mm02_00304572 predicted 2310
10 SASI_Mm02_00304573 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161550 predicted 511
2 SASI_Mm01_00161551 predicted 2552
3 SASI_Mm01_00161552 predicted 577
4 SASI_Mm01_00161553 predicted 447
5 SASI_Mm01_00161554 predicted 1417
6 SASI_Mm01_00161555 predicted 943
7 SASI_Mm01_00161557 predicted 565
8 SASI_Mm01_00161558 predicted 1130
9 SASI_Mm01_00161559 predicted 2310
10 SASI_Mm02_00320654 predicted 401
11 SASI_Mm01_00161556 predicted 2389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004247
VALIDATED
EFTUD2 MISSION shRNA Bacterial Glycerol Stock
elongation factor Tu GTP binding domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-535s21c1
Sequence:CCGGCCCATTATTAAGCCAGTGAAACTCGAGTTTCACTGGCTTAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-3386s21c1
Sequence:CCGGCGGGCTCCATTCCCAAGGAAACTCGAGTTTCCTTGGGAATGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-522s21c1
Sequence:CCGGGCCTCTCACAGAACCCATTATCTCGAGATAATGGGTTCTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-2282s21c1
Sequence:CCGGGCTTTGCTGAAACGCCTAATACTCGAGTATTAGGCGTTTCAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-2994s21c1
Sequence:CCGGCCTGGACAAGAGCATTGTCATCTCGAGATGACAATGCTCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004247.2-3156s1c1
Sequence:CCGGCGGGCTCCATTCCCAAGGAAACTCGAGTTTCCTTGGGAATGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004247.2-2052s1c1
Sequence:CCGGGCTTTGCTGAAACGCCTAATACTCGAGTATTAGGCGTTTCAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-292s1c1
Sequence:CCGGGCCTCTCACAGAACCCATTATCTCGAGATAATGGGTTCTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-2764s1c1
Sequence:CCGGCCTGGACAAGAGCATTGTCATCTCGAGATGACAATGCTCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-305s1c1
Sequence:CCGGCCCATTATTAAGCCAGTGAAACTCGAGTTTCACTGGCTTAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004247
VALIDATED
EFTUD2 MISSION shRNA shRNA Plasmid DNA
elongation factor Tu GTP binding domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-535s21c1
Sequence:CCGGCCCATTATTAAGCCAGTGAAACTCGAGTTTCACTGGCTTAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-3386s21c1
Sequence:CCGGCGGGCTCCATTCCCAAGGAAACTCGAGTTTCCTTGGGAATGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-522s21c1
Sequence:CCGGGCCTCTCACAGAACCCATTATCTCGAGATAATGGGTTCTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-2282s21c1
Sequence:CCGGGCTTTGCTGAAACGCCTAATACTCGAGTATTAGGCGTTTCAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-2994s21c1
Sequence:CCGGCCTGGACAAGAGCATTGTCATCTCGAGATGACAATGCTCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004247.2-3156s1c1
Sequence:CCGGCGGGCTCCATTCCCAAGGAAACTCGAGTTTCCTTGGGAATGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004247.2-2052s1c1
Sequence:CCGGGCTTTGCTGAAACGCCTAATACTCGAGTATTAGGCGTTTCAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-292s1c1
Sequence:CCGGGCCTCTCACAGAACCCATTATCTCGAGATAATGGGTTCTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-2764s1c1
Sequence:CCGGCCTGGACAAGAGCATTGTCATCTCGAGATGACAATGCTCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-305s1c1
Sequence:CCGGCCCATTATTAAGCCAGTGAAACTCGAGTTTCACTGGCTTAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004247
VALIDATED
EFTUD2 MISSION shRNA Lentiviral Transduction Particles
elongation factor Tu GTP binding domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-535s21c1
Sequence:CCGGCCCATTATTAAGCCAGTGAAACTCGAGTTTCACTGGCTTAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-3386s21c1
Sequence:CCGGCGGGCTCCATTCCCAAGGAAACTCGAGTTTCCTTGGGAATGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-522s21c1
Sequence:CCGGGCCTCTCACAGAACCCATTATCTCGAGATAATGGGTTCTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-2282s21c1
Sequence:CCGGGCTTTGCTGAAACGCCTAATACTCGAGTATTAGGCGTTTCAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004247.3-2994s21c1
Sequence:CCGGCCTGGACAAGAGCATTGTCATCTCGAGATGACAATGCTCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004247.2-3156s1c1
Sequence:CCGGCGGGCTCCATTCCCAAGGAAACTCGAGTTTCCTTGGGAATGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004247.2-2052s1c1
Sequence:CCGGGCTTTGCTGAAACGCCTAATACTCGAGTATTAGGCGTTTCAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-292s1c1
Sequence:CCGGGCCTCTCACAGAACCCATTATCTCGAGATAATGGGTTCTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-2764s1c1
Sequence:CCGGCCTGGACAAGAGCATTGTCATCTCGAGATGACAATGCTCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004247.2-305s1c1
Sequence:CCGGCCCATTATTAAGCCAGTGAAACTCGAGTTTCACTGGCTTAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011431
VALIDATED
EFTUD2 MISSION shRNA Bacterial Glycerol Stock
elongation factor Tu GTP binding domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-1904s21c1
Sequence:CCGGCGCAAGGTCAACAAGAGCTATCTCGAGATAGCTCTTGTTGACCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-356s21c1
Sequence:CCGGCCCATTATAAAGCCAGTGAAACTCGAGTTTCACTGGCTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-3061s21c1
Sequence:CCGGTGAGCATCGGGAACTGCTATGCTCGAGCATAGCAGTTCCCGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011431.3-2972s21c1
Sequence:CCGGCAGGATGTTGTGCTCAATTATCTCGAGATAATTGAGCACAACATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-510s21c1
Sequence:CCGGCCTGTTTCGTAGATTGTTTAACTCGAGTTAAACAATCTACGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011431.2-3077s1c1
Sequence:CCGGCCTGGTTTCTTCTGTGGCCTTCTCGAGAAGGCCACAGAAGAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011431.2-298s1c1
Sequence:CCGGCCCATTATAAAGCCAGTGAAACTCGAGTTTCACTGGCTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-2542s1c1
Sequence:CCGGGCAGATTGTGTGTCTGCTGTTCTCGAGAACAGCAGACACACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-452s1c1
Sequence:CCGGCCTGTTTCGTAGATTGTTTAACTCGAGTTAAACAATCTACGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-1846s1c1
Sequence:CCGGCGCAAGGTCAACAAGAGCTATCTCGAGATAGCTCTTGTTGACCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011431
VALIDATED
EFTUD2 MISSION shRNA shRNA Plasmid DNA
elongation factor Tu GTP binding domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-1904s21c1
Sequence:CCGGCGCAAGGTCAACAAGAGCTATCTCGAGATAGCTCTTGTTGACCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-356s21c1
Sequence:CCGGCCCATTATAAAGCCAGTGAAACTCGAGTTTCACTGGCTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-3061s21c1
Sequence:CCGGTGAGCATCGGGAACTGCTATGCTCGAGCATAGCAGTTCCCGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011431.3-2972s21c1
Sequence:CCGGCAGGATGTTGTGCTCAATTATCTCGAGATAATTGAGCACAACATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-510s21c1
Sequence:CCGGCCTGTTTCGTAGATTGTTTAACTCGAGTTAAACAATCTACGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011431.2-3077s1c1
Sequence:CCGGCCTGGTTTCTTCTGTGGCCTTCTCGAGAAGGCCACAGAAGAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011431.2-298s1c1
Sequence:CCGGCCCATTATAAAGCCAGTGAAACTCGAGTTTCACTGGCTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-2542s1c1
Sequence:CCGGGCAGATTGTGTGTCTGCTGTTCTCGAGAACAGCAGACACACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-452s1c1
Sequence:CCGGCCTGTTTCGTAGATTGTTTAACTCGAGTTAAACAATCTACGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-1846s1c1
Sequence:CCGGCGCAAGGTCAACAAGAGCTATCTCGAGATAGCTCTTGTTGACCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011431
VALIDATED
EFTUD2 MISSION shRNA Lentiviral Transduction Particles
elongation factor Tu GTP binding domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-1904s21c1
Sequence:CCGGCGCAAGGTCAACAAGAGCTATCTCGAGATAGCTCTTGTTGACCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-356s21c1
Sequence:CCGGCCCATTATAAAGCCAGTGAAACTCGAGTTTCACTGGCTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-3061s21c1
Sequence:CCGGTGAGCATCGGGAACTGCTATGCTCGAGCATAGCAGTTCCCGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011431.3-2972s21c1
Sequence:CCGGCAGGATGTTGTGCTCAATTATCTCGAGATAATTGAGCACAACATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011431.3-510s21c1
Sequence:CCGGCCTGTTTCGTAGATTGTTTAACTCGAGTTAAACAATCTACGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011431.2-3077s1c1
Sequence:CCGGCCTGGTTTCTTCTGTGGCCTTCTCGAGAAGGCCACAGAAGAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011431.2-298s1c1
Sequence:CCGGCCCATTATAAAGCCAGTGAAACTCGAGTTTCACTGGCTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-2542s1c1
Sequence:CCGGGCAGATTGTGTGTCTGCTGTTCTCGAGAACAGCAGACACACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-452s1c1
Sequence:CCGGCCTGTTTCGTAGATTGTTTAACTCGAGTTAAACAATCTACGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011431.2-1846s1c1
Sequence:CCGGCGCAAGGTCAACAAGAGCTATCTCGAGATAGCTCTTGTTGACCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks