EMAIL THIS PAGE TO A FRIEND

EGF

epidermal growth factor

73 Gene Product Result for
Synonyms: HOMG4 URG
UniProtKB ID: P01133, B4DRK7, E7EVD2, E9PBF0, Q52LZ6
Gene ID:
Human(1950) Summary: This gene encodes a member of the epidermal growth factor superfamily. The encoded protein is synthesized as a large precursor molecule that is proteolytically cleaved to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding the high affinity cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(13645) epidermal growth factor
Rat(25313) epidermal growth factor
Zebrafish(403045) epidermal growth factor
cow(530315) epidermal growth factor
Horse(100034179) epidermal growth factor
dog(403657) epidermal growth factor
domestic cat(493978) epidermal growth factor
chicken(408035) epidermal growth factor
domestic guinea pig(100714471) epidermal growth factor
naked mole-rat(101704789) epidermal growth factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S2671 Suramin sodium salt ≥99% (TLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001963 Rosetta Predictions human pricing
NM_012842 Rosetta Predictions rat pricing
NM_010113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184810 predicted 1549
2 SASI_Hs01_00184812 predicted 2301
3 SASI_Hs01_00184813 predicted 2967
4 SASI_Hs01_00184814 predicted 2030
5 SASI_Hs02_00332915 predicted 2181
6 SASI_Hs02_00332916 predicted 1182
7 SASI_Hs01_00184815 predicted 1989
8 SASI_Hs01_00184816 predicted 4000
9 SASI_Hs01_00184817 predicted 3279
10 SASI_Hs02_00332917 predicted 3923
11 SASI_Hs01_00184811 predicted 2018
12 SASI_Hs01_00184818 predicted 697
13 SASI_Hs01_00184819 predicted 1812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071448 predicted 1597
2 SASI_Rn01_00071449 predicted 1191
3 SASI_Rn01_00071450 predicted 1559
4 SASI_Rn01_00071451 predicted 990
5 SASI_Rn01_00071452 predicted 2178
6 SASI_Rn01_00071454 predicted 868
7 SASI_Rn01_00071455 predicted 649
8 SASI_Rn01_00071456 predicted 3412
9 SASI_Rn01_00071457 predicted 3605
10 SASI_Rn02_00260309 predicted 1695
11 SASI_Rn01_00071453 predicted 1864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034060 predicted 3268
2 SASI_Mm01_00034061 predicted 1258
3 SASI_Mm01_00034062 predicted 737
4 SASI_Mm02_00317827 predicted 1464
5 SASI_Mm01_00034063 predicted 533
6 SASI_Mm01_00034064 predicted 637
7 SASI_Mm01_00034065 predicted 2312
8 SASI_Mm02_00317828 predicted 4070
9 SASI_Mm01_00034066 predicted 1786
10 SASI_Mm01_00034067 predicted 3530
11 SASI_Mm01_00034058 predicted 2814
12 SASI_Mm01_00034059 predicted 2305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001963
EGF MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-4004s1c1
Sequence:CCGGGCTAACCCATTATGGCAACAACTCGAGTTGTTGCCATAATGGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-1697s1c1
Sequence:CCGGCCCTTATGTTTCTGTCCTGAACTCGAGTTCAGGACAGAAACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-3334s1c1
Sequence:CCGGCCACCACTATTCCGTAAGAAACTCGAGTTTCTTACGGAATAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-2240s1c1
Sequence:CCGGCCACGAGGAATTGCTGTTCATCTCGAGATGAACAGCAATTCCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-2554s1c1
Sequence:CCGGGCCATCAGTAATAAGAGTAAACTCGAGTTTACTCTTATTACTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-2521s21c1
Sequence:CCGGTAGCAGTGTTTGAGGATTATGCTCGAGCATAATCCTCAAACACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001963.3-4170s21c1
Sequence:CCGGTCCACAATCTCTACGACTAATCTCGAGATTAGTCGTAGAGATTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-1178s21c1
Sequence:CCGGACATCCAACACAGCATAATTTCTCGAGAAATTATGCTGTGTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-2055s21c1
Sequence:CCGGTGGATAGAGAGAGCTAATATGCTCGAGCATATTAGCTCTCTCTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001963
EGF MISSION shRNA shRNA Plasmid DNA
epidermal growth factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-4004s1c1
Sequence:CCGGGCTAACCCATTATGGCAACAACTCGAGTTGTTGCCATAATGGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-1697s1c1
Sequence:CCGGCCCTTATGTTTCTGTCCTGAACTCGAGTTCAGGACAGAAACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-3334s1c1
Sequence:CCGGCCACCACTATTCCGTAAGAAACTCGAGTTTCTTACGGAATAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-2240s1c1
Sequence:CCGGCCACGAGGAATTGCTGTTCATCTCGAGATGAACAGCAATTCCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-2554s1c1
Sequence:CCGGGCCATCAGTAATAAGAGTAAACTCGAGTTTACTCTTATTACTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-2521s21c1
Sequence:CCGGTAGCAGTGTTTGAGGATTATGCTCGAGCATAATCCTCAAACACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001963.3-4170s21c1
Sequence:CCGGTCCACAATCTCTACGACTAATCTCGAGATTAGTCGTAGAGATTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-1178s21c1
Sequence:CCGGACATCCAACACAGCATAATTTCTCGAGAAATTATGCTGTGTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-2055s21c1
Sequence:CCGGTGGATAGAGAGAGCTAATATGCTCGAGCATATTAGCTCTCTCTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001963
EGF MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-4004s1c1
Sequence:CCGGGCTAACCCATTATGGCAACAACTCGAGTTGTTGCCATAATGGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-1697s1c1
Sequence:CCGGCCCTTATGTTTCTGTCCTGAACTCGAGTTCAGGACAGAAACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-3334s1c1
Sequence:CCGGCCACCACTATTCCGTAAGAAACTCGAGTTTCTTACGGAATAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-2240s1c1
Sequence:CCGGCCACGAGGAATTGCTGTTCATCTCGAGATGAACAGCAATTCCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001963.2-2554s1c1
Sequence:CCGGGCCATCAGTAATAAGAGTAAACTCGAGTTTACTCTTATTACTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-2521s21c1
Sequence:CCGGTAGCAGTGTTTGAGGATTATGCTCGAGCATAATCCTCAAACACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001963.3-4170s21c1
Sequence:CCGGTCCACAATCTCTACGACTAATCTCGAGATTAGTCGTAGAGATTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-1178s21c1
Sequence:CCGGACATCCAACACAGCATAATTTCTCGAGAAATTATGCTGTGTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001963.3-2055s21c1
Sequence:CCGGTGGATAGAGAGAGCTAATATGCTCGAGCATATTAGCTCTCTCTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010113
EGF MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-3265s1c1
Sequence:CCGGGCCACCATTTGGACCGAAATACTCGAGTATTTCGGTCCAAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-2125s1c1
Sequence:CCGGGCGGGAAGCATCATCGAATAACTCGAGTTATTCGATGATGCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-927s1c1
Sequence:CCGGGCACACCTCAAAGGTGTTGATCTCGAGATCAACACCTTTGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-2483s1c1
Sequence:CCGGCCCATCGGTAATAAGGGTGAACTCGAGTTCACCCTTATTACCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-1468s1c1
Sequence:CCGGGCTGTACTCTTGGGTGTGAAACTCGAGTTTCACACCCAAGAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010113
EGF MISSION shRNA shRNA Plasmid DNA
epidermal growth factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-3265s1c1
Sequence:CCGGGCCACCATTTGGACCGAAATACTCGAGTATTTCGGTCCAAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-2125s1c1
Sequence:CCGGGCGGGAAGCATCATCGAATAACTCGAGTTATTCGATGATGCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-927s1c1
Sequence:CCGGGCACACCTCAAAGGTGTTGATCTCGAGATCAACACCTTTGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-2483s1c1
Sequence:CCGGCCCATCGGTAATAAGGGTGAACTCGAGTTCACCCTTATTACCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-1468s1c1
Sequence:CCGGGCTGTACTCTTGGGTGTGAAACTCGAGTTTCACACCCAAGAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010113
EGF MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-3265s1c1
Sequence:CCGGGCCACCATTTGGACCGAAATACTCGAGTATTTCGGTCCAAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-2125s1c1
Sequence:CCGGGCGGGAAGCATCATCGAATAACTCGAGTTATTCGATGATGCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-927s1c1
Sequence:CCGGGCACACCTCAAAGGTGTTGATCTCGAGATCAACACCTTTGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-2483s1c1
Sequence:CCGGCCCATCGGTAATAAGGGTGAACTCGAGTTCACCCTTATTACCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010113.1-1468s1c1
Sequence:CCGGGCTGTACTCTTGGGTGTGAAACTCGAGTTTCACACCCAAGAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks