EMAIL THIS PAGE TO A FRIEND

EGFL6

EGF-like-domain, multiple 6

49 Gene Product Result for
Synonyms: MAEG W80
Gene ID:
Human(25975) Summary: This gene encodes a member of the epidermal growth factor (EGF) repeat superfamily. Members of this superfamily are characterized by the presence of EGF-like repeats and are often involved in the regulation of cell cycle, proliferation, and developmental processes. The gene product contains a signal peptide, suggesting that it is secreted; an EGF repeat region consisting of 4 complete EGF-like repeats and 1 partial EGF-like repeat, 3 of which have a calcium-binding consensus sequence; an arg-gly-asp integrin association motif; and a MAM domain, which is believed to have an adhesive function. This gene is expressed early during development, and its expression has been detected in lung and meningioma tumors. [provided by RefSeq, Jul 2008]
Mouse(54156) EGF-like-domain, multiple 6
Rat(317470) EGF-like-domain, multiple 6
Zebrafish(436730) EGF-like-domain, multiple 6
chicken(418637) EGF-like-domain, multiple 6
dog(491745) EGF-like-domain, multiple 6
domestic cat(101092495) EGF-like-domain, multiple 6
cow(781765) EGF-like-domain, multiple 6
Horse(100054915) EGF-like-domain, multiple 6
domestic guinea pig(100735884) EGF-like-domain, multiple 6
naked mole-rat(101725047) EGF-like-domain, multiple 6
sheep(101121916) EGF-like-domain, multiple 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015507 Rosetta Predictions human pricing
NM_001108254 Rosetta Predictions rat pricing
NM_019397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243060 predicted 1864
2 SASI_Hs01_00243062 predicted 521
3 SASI_Hs01_00243063 predicted 1957
4 SASI_Hs01_00243065 predicted 849
5 SASI_Hs01_00243066 predicted 988
6 SASI_Hs02_00347987 predicted 513
7 SASI_Hs01_00243068 predicted 1397
8 SASI_Hs01_00243069 predicted 616
9 SASI_Hs02_00347988 predicted 1501
10 SASI_Hs02_00347989 predicted 788
11 SASI_Hs01_00243061 predicted 828
12 SASI_Hs01_00243064 predicted 834
13 SASI_Hs01_00243067 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236844 predicted 477
2 SASI_Rn02_00236845 predicted 908
3 SASI_Rn02_00236846 predicted 780
4 SASI_Rn02_00236847 predicted 271
5 SASI_Rn02_00236848 predicted 1464
6 SASI_Rn02_00236849 predicted 364
7 SASI_Rn02_00236850 predicted 832
8 SASI_Rn02_00236851 predicted 899
9 SASI_Rn02_00236852 predicted 968
10 SASI_Rn02_00236853 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133140 predicted 556
2 SASI_Mm02_00324318 predicted 1455
3 SASI_Mm02_00324319 predicted 519
4 SASI_Mm01_00133142 predicted 822
5 SASI_Mm01_00133143 predicted 695
6 SASI_Mm01_00133144 predicted 264
7 SASI_Mm01_00133145 predicted 364
8 SASI_Mm01_00133146 predicted 1511
9 SASI_Mm01_00133147 predicted 416
10 SASI_Mm01_00133148 predicted 784
11 SASI_Mm01_00133141 predicted 1460
12 SASI_Mm01_00133149 predicted 1703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015507
EGFL6 MISSION shRNA Bacterial Glycerol Stock
EGF-like-domain, multiple 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1183s1c1
Sequence:CCGGCCCTTCAACTATGAAGAGATACTCGAGTATCTCTTCATAGTTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1663s1c1
Sequence:CCGGGTCGGGAAACTTCGAGTGTTTCTCGAGAAACACTCGAAGTTTCCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1558s1c1
Sequence:CCGGGCAGGTCACAAGAAAGACATTCTCGAGAATGTCTTTCTTGTGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-554s1c1
Sequence:CCGGGCCAACACAGATGTGTGAATACTCGAGTATTCACACATCTGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-632s1c1
Sequence:CCGGCGTGTGTGAACTCTAGGACATCTCGAGATGTCCTAGAGTTCACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015507.3-2151s21c1
Sequence:CCGGCTGAATCTTTCCACATTATATCTCGAGATATAATGTGGAAAGATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015507.3-2239s21c1
Sequence:CCGGGAGCTTCTCTCTACAACATTTCTCGAGAAATGTTGTAGAGAGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015507.3-1022s21c1
Sequence:CCGGTAAATGCAAGCAGGGATATAACTCGAGTTATATCCCTGCTTGCATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015507.3-1944s21c1
Sequence:CCGGGACTGAATGTTACTATCTTTACTCGAGTAAAGATAGTAACATTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015507
EGFL6 MISSION shRNA shRNA Plasmid DNA
EGF-like-domain, multiple 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1183s1c1
Sequence:CCGGCCCTTCAACTATGAAGAGATACTCGAGTATCTCTTCATAGTTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1663s1c1
Sequence:CCGGGTCGGGAAACTTCGAGTGTTTCTCGAGAAACACTCGAAGTTTCCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1558s1c1
Sequence:CCGGGCAGGTCACAAGAAAGACATTCTCGAGAATGTCTTTCTTGTGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-554s1c1
Sequence:CCGGGCCAACACAGATGTGTGAATACTCGAGTATTCACACATCTGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-632s1c1
Sequence:CCGGCGTGTGTGAACTCTAGGACATCTCGAGATGTCCTAGAGTTCACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015507.3-2151s21c1
Sequence:CCGGCTGAATCTTTCCACATTATATCTCGAGATATAATGTGGAAAGATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015507.3-2239s21c1
Sequence:CCGGGAGCTTCTCTCTACAACATTTCTCGAGAAATGTTGTAGAGAGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015507.3-1022s21c1
Sequence:CCGGTAAATGCAAGCAGGGATATAACTCGAGTTATATCCCTGCTTGCATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015507.3-1944s21c1
Sequence:CCGGGACTGAATGTTACTATCTTTACTCGAGTAAAGATAGTAACATTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015507
EGFL6 MISSION shRNA Lentiviral Transduction Particles
EGF-like-domain, multiple 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1183s1c1
Sequence:CCGGCCCTTCAACTATGAAGAGATACTCGAGTATCTCTTCATAGTTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1663s1c1
Sequence:CCGGGTCGGGAAACTTCGAGTGTTTCTCGAGAAACACTCGAAGTTTCCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-1558s1c1
Sequence:CCGGGCAGGTCACAAGAAAGACATTCTCGAGAATGTCTTTCTTGTGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-554s1c1
Sequence:CCGGGCCAACACAGATGTGTGAATACTCGAGTATTCACACATCTGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015507.2-632s1c1
Sequence:CCGGCGTGTGTGAACTCTAGGACATCTCGAGATGTCCTAGAGTTCACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015507.3-2151s21c1
Sequence:CCGGCTGAATCTTTCCACATTATATCTCGAGATATAATGTGGAAAGATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015507.3-2239s21c1
Sequence:CCGGGAGCTTCTCTCTACAACATTTCTCGAGAAATGTTGTAGAGAGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015507.3-1022s21c1
Sequence:CCGGTAAATGCAAGCAGGGATATAACTCGAGTTATATCCCTGCTTGCATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015507.3-1944s21c1
Sequence:CCGGGACTGAATGTTACTATCTTTACTCGAGTAAAGATAGTAACATTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019397
EGFL6 MISSION shRNA Bacterial Glycerol Stock
EGF-like-domain, multiple 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-418s1c1
Sequence:CCGGCCGAATAAATGTAGATGCTTTCTCGAGAAAGCATCTACATTTATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-827s1c1
Sequence:CCGGGCCGATATGATTGTGTAGATACTCGAGTATCTACACAATCATATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019397.1-2049s1c1
Sequence:CCGGGCCTTCTCATTTGTTTCTGAACTCGAGTTCAGAAACAAATGAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-826s1c1
Sequence:CCGGCGCCGATATGATTGTGTAGATCTCGAGATCTACACAATCATATCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-1456s1c1
Sequence:CCGGGCTGATCGAGACAATGATGTTCTCGAGAACATCATTGTCTCGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019397
EGFL6 MISSION shRNA shRNA Plasmid DNA
EGF-like-domain, multiple 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-418s1c1
Sequence:CCGGCCGAATAAATGTAGATGCTTTCTCGAGAAAGCATCTACATTTATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-827s1c1
Sequence:CCGGGCCGATATGATTGTGTAGATACTCGAGTATCTACACAATCATATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019397.1-2049s1c1
Sequence:CCGGGCCTTCTCATTTGTTTCTGAACTCGAGTTCAGAAACAAATGAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-826s1c1
Sequence:CCGGCGCCGATATGATTGTGTAGATCTCGAGATCTACACAATCATATCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-1456s1c1
Sequence:CCGGGCTGATCGAGACAATGATGTTCTCGAGAACATCATTGTCTCGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019397
EGFL6 MISSION shRNA Lentiviral Transduction Particles
EGF-like-domain, multiple 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-418s1c1
Sequence:CCGGCCGAATAAATGTAGATGCTTTCTCGAGAAAGCATCTACATTTATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-827s1c1
Sequence:CCGGGCCGATATGATTGTGTAGATACTCGAGTATCTACACAATCATATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019397.1-2049s1c1
Sequence:CCGGGCCTTCTCATTTGTTTCTGAACTCGAGTTCAGAAACAAATGAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-826s1c1
Sequence:CCGGCGCCGATATGATTGTGTAGATCTCGAGATCTACACAATCATATCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019397.1-1456s1c1
Sequence:CCGGGCTGATCGAGACAATGATGTTCTCGAGAACATCATTGTCTCGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)