EMAIL THIS PAGE TO A FRIEND

EGFL7

EGF-like-domain, multiple 7

81 Gene Product Result for
Synonyms: NEU1 RP11-251M1.2 VE-STATIN ZNEU1
UniProtKB ID: Q9UHF1, B3KRP0, Q5M7Y5, Q5VUD5, Q96EG0
Gene ID:
Human(51162) Summary: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Mouse(353156) EGF-like domain 7
Rat(245963) EGF-like-domain, multiple 7
sheep(101114767) EGF-like-domain, multiple 7
naked mole-rat(101704909) EGF-like-domain, multiple 7
domestic guinea pig(100724860) EGF-like-domain, multiple 7
Zebrafish(678640) EGF-like-domain, multiple 7
chicken(417137) EGF-like-domain, multiple 7
domestic cat(101089659) EGF-like-domain, multiple 7
cow(613671) EGF-like-domain, multiple 7
dog(491250) EGF-like-domain, multiple 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016215 Rosetta Predictions human pricing
NM_201446 Rosetta Predictions human pricing
NM_139104 Rosetta Predictions rat pricing
NM_178444 Rosetta Predictions mouse pricing
NM_198724 Rosetta Predictions mouse pricing
NM_198725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148445 predicted 502
2 SASI_Hs01_00148446 predicted 826
3 SASI_Hs01_00148447 predicted 1226
4 SASI_Hs01_00148448 predicted 879
5 SASI_Hs02_00349068 predicted 884
6 SASI_Hs01_00148450 predicted 706
7 SASI_Hs01_00148451 predicted 712
8 SASI_Hs01_00148452 predicted 506
9 SASI_Hs01_00148453 predicted 725
10 SASI_Hs02_00349069 predicted 880
11 SASI_Hs01_00148449 predicted 907
12 SASI_Hs01_00148454 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199986 predicted 497
2 SASI_Hs01_00199987 predicted 830
3 SASI_Hs01_00199988 predicted 1229
4 SASI_Hs01_00199989 predicted 879
5 SASI_Hs02_00372984 predicted 891
6 SASI_Hs01_00199991 predicted 705
7 SASI_Hs01_00199992 predicted 718
8 SASI_Hs01_00199993 predicted 512
9 SASI_Hs01_00199994 predicted 722
10 SASI_Hs02_00372985 predicted 880
11 SASI_Hs01_00199990 predicted 912
12 SASI_Hs01_00199995 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105058 predicted 714
2 SASI_Rn02_00268479 predicted 1281
3 SASI_Rn01_00105059 predicted 1241
4 SASI_Rn01_00105060 predicted 1254
5 SASI_Rn01_00105061 predicted 1618
6 SASI_Rn01_00105062 predicted 1279
7 SASI_Rn01_00105063 predicted 748
8 SASI_Rn01_00105064 predicted 1485
9 SASI_Rn01_00105066 predicted 789
10 SASI_Rn01_00105067 predicted 1477
11 SASI_Rn01_00105065 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163565 predicted 415
2 SASI_Mm01_00163566 predicted 678
3 SASI_Mm01_00163567 predicted 787
4 SASI_Mm01_00163568 predicted 689
5 SASI_Mm01_00163569 predicted 388
6 SASI_Mm01_00163570 predicted 492
7 SASI_Mm01_00163571 predicted 427
8 SASI_Mm01_00163572 predicted 740
9 SASI_Mm01_00163573 predicted 635
10 SASI_Mm01_00163574 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091038 predicted 430
2 SASI_Mm01_00091039 predicted 686
3 SASI_Mm01_00091040 predicted 796
4 SASI_Mm01_00091041 predicted 706
5 SASI_Mm01_00091042 predicted 399
6 SASI_Mm01_00091043 predicted 501
7 SASI_Mm01_00091044 predicted 434
8 SASI_Mm01_00091045 predicted 757
9 SASI_Mm01_00091046 predicted 643
10 SASI_Mm01_00091047 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153970 predicted 433
2 SASI_Mm01_00153971 predicted 699
3 SASI_Mm01_00153972 predicted 809
4 SASI_Mm01_00153973 predicted 718
5 SASI_Mm01_00153974 predicted 412
6 SASI_Mm01_00153975 predicted 515
7 SASI_Mm01_00153976 predicted 451
8 SASI_Mm01_00153977 predicted 769
9 SASI_Mm01_00153978 predicted 657
10 SASI_Mm01_00153979 predicted 495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016215
EGFL7 MISSION shRNA Bacterial Glycerol Stock
EGF-like-domain, multiple 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016215.3-786s21c1
Sequence:CCGGCAGTTACTGGTGCCAGTGTTGCTCGAGCAACACTGGCACCAGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016215.3-1120s21c1
Sequence:CCGGTGCAAGAAAGACTCGTGACTGCTCGAGCAGTCACGAGTCTTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-716s1c1
Sequence:CCGGGCCAGTCAGATGTGGATGAATCTCGAGATTCATCCACATCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-503s1c1
Sequence:CCGGGCACCTACCGAACCATCTATACTCGAGTATAGATGGTTCGGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-1077s1c1
Sequence:CCGGCGAGCAGATTTCCTTCCTGGACTCGAGTCCAGGAAGGAAATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-885s1c1
Sequence:CCGGAGGAGTGGACAGTGCAATGAACTCGAGTTCATTGCACTGTCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-831s1c1
Sequence:CCGGCGGTACACTCTGTGTGCCCAACTCGAGTTGGGCACACAGAGTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016215
EGFL7 MISSION shRNA shRNA Plasmid DNA
EGF-like-domain, multiple 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016215.3-786s21c1
Sequence:CCGGCAGTTACTGGTGCCAGTGTTGCTCGAGCAACACTGGCACCAGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016215.3-1120s21c1
Sequence:CCGGTGCAAGAAAGACTCGTGACTGCTCGAGCAGTCACGAGTCTTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-716s1c1
Sequence:CCGGGCCAGTCAGATGTGGATGAATCTCGAGATTCATCCACATCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-503s1c1
Sequence:CCGGGCACCTACCGAACCATCTATACTCGAGTATAGATGGTTCGGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-1077s1c1
Sequence:CCGGCGAGCAGATTTCCTTCCTGGACTCGAGTCCAGGAAGGAAATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-885s1c1
Sequence:CCGGAGGAGTGGACAGTGCAATGAACTCGAGTTCATTGCACTGTCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-831s1c1
Sequence:CCGGCGGTACACTCTGTGTGCCCAACTCGAGTTGGGCACACAGAGTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016215
EGFL7 MISSION shRNA Lentiviral Transduction Particles
EGF-like-domain, multiple 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016215.3-786s21c1
Sequence:CCGGCAGTTACTGGTGCCAGTGTTGCTCGAGCAACACTGGCACCAGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016215.3-1120s21c1
Sequence:CCGGTGCAAGAAAGACTCGTGACTGCTCGAGCAGTCACGAGTCTTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-716s1c1
Sequence:CCGGGCCAGTCAGATGTGGATGAATCTCGAGATTCATCCACATCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-503s1c1
Sequence:CCGGGCACCTACCGAACCATCTATACTCGAGTATAGATGGTTCGGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-1077s1c1
Sequence:CCGGCGAGCAGATTTCCTTCCTGGACTCGAGTCCAGGAAGGAAATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-885s1c1
Sequence:CCGGAGGAGTGGACAGTGCAATGAACTCGAGTTCATTGCACTGTCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016215.3-831s1c1
Sequence:CCGGCGGTACACTCTGTGTGCCCAACTCGAGTTGGGCACACAGAGTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178444
VALIDATED
EGFL7 MISSION shRNA Bacterial Glycerol Stock
EGF-like-domain, multiple 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-421s21c1
Sequence:CCGGGACCTTTGTGCAGCGTGTATACTCGAGTATACACGCTGCACAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-320s21c1
Sequence:CCGGGCATGGTTTCTAGTGTTGGCACTCGAGTGCCAACACTAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-696s21c1
Sequence:CCGGGCCAGACAGATGTTGATGAATCTCGAGATTCATCAACATCTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-1144s21c1
Sequence:CCGGATAGAGCAGTCATCCCTAGATCTCGAGATCTAGGGATGACTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-594s21c1
Sequence:CCGGGGGCTTGTGGAGCAGCAATATCTCGAGATATTGCTGCTCCACAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-689s1c1
Sequence:CCGGGATACTTGCCAGACAGATGTTCTCGAGAACATCTGTCTGGCAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-696s1c1
Sequence:CCGGGCCAGACAGATGTTGATGAATCTCGAGATTCATCAACATCTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-747s1c1
Sequence:CCGGGCTGTGTCAATACTGTGGGAACTCGAGTTCCCACAGTATTGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-320s1c1
Sequence:CCGGGCATGGTTTCTAGTGTTGGCACTCGAGTGCCAACACTAGAAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178444
VALIDATED
EGFL7 MISSION shRNA shRNA Plasmid DNA
EGF-like-domain, multiple 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-421s21c1
Sequence:CCGGGACCTTTGTGCAGCGTGTATACTCGAGTATACACGCTGCACAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-320s21c1
Sequence:CCGGGCATGGTTTCTAGTGTTGGCACTCGAGTGCCAACACTAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-696s21c1
Sequence:CCGGGCCAGACAGATGTTGATGAATCTCGAGATTCATCAACATCTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-1144s21c1
Sequence:CCGGATAGAGCAGTCATCCCTAGATCTCGAGATCTAGGGATGACTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-594s21c1
Sequence:CCGGGGGCTTGTGGAGCAGCAATATCTCGAGATATTGCTGCTCCACAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-689s1c1
Sequence:CCGGGATACTTGCCAGACAGATGTTCTCGAGAACATCTGTCTGGCAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-696s1c1
Sequence:CCGGGCCAGACAGATGTTGATGAATCTCGAGATTCATCAACATCTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-747s1c1
Sequence:CCGGGCTGTGTCAATACTGTGGGAACTCGAGTTCCCACAGTATTGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-320s1c1
Sequence:CCGGGCATGGTTTCTAGTGTTGGCACTCGAGTGCCAACACTAGAAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178444
VALIDATED
EGFL7 MISSION shRNA Lentiviral Transduction Particles
EGF-like-domain, multiple 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-421s21c1
Sequence:CCGGGACCTTTGTGCAGCGTGTATACTCGAGTATACACGCTGCACAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-320s21c1
Sequence:CCGGGCATGGTTTCTAGTGTTGGCACTCGAGTGCCAACACTAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-696s21c1
Sequence:CCGGGCCAGACAGATGTTGATGAATCTCGAGATTCATCAACATCTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-1144s21c1
Sequence:CCGGATAGAGCAGTCATCCCTAGATCTCGAGATCTAGGGATGACTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178444.3-594s21c1
Sequence:CCGGGGGCTTGTGGAGCAGCAATATCTCGAGATATTGCTGCTCCACAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-689s1c1
Sequence:CCGGGATACTTGCCAGACAGATGTTCTCGAGAACATCTGTCTGGCAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-696s1c1
Sequence:CCGGGCCAGACAGATGTTGATGAATCTCGAGATTCATCAACATCTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-747s1c1
Sequence:CCGGGCTGTGTCAATACTGTGGGAACTCGAGTTCCCACAGTATTGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178444.3-320s1c1
Sequence:CCGGGCATGGTTTCTAGTGTTGGCACTCGAGTGCCAACACTAGAAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks