EMAIL THIS PAGE TO A FRIEND

EGFL8

EGF-like-domain, multiple 8

81 Gene Product Result for
Synonyms: C6orf8 NG3
UniProtKB ID: Q99944, B0S884, G5E9Q0, Q5JP23, Q5SSX3, Q8IV30
Gene ID:
Mouse(81701) EGF-like domain 8
Rat(406166) EGF-like-domain, multiple 8
cow(782820) EGF-like-domain, multiple 8
domestic cat(101095824) EGF-like-domain, multiple 8
dog(481725) EGF-like-domain, multiple 8
domestic guinea pig(100726405) EGF-like-domain, multiple 8
naked mole-rat(101711649) EGF-like-domain, multiple 8
sheep(101122638) EGF-like-domain, multiple 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030652 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030652 Rosetta Predictions human pricing
NM_001004070 Rosetta Predictions rat pricing
NM_152922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189478 predicted 472
2 SASI_Hs01_00189479 predicted 785
3 SASI_Hs01_00189480 predicted 623
4 SASI_Hs01_00189481 predicted 978
5 SASI_Hs01_00189482 predicted 919
6 SASI_Hs02_00358231 predicted 387
7 SASI_Hs01_00189484 predicted 1007
8 SASI_Hs01_00189485 predicted 514
9 SASI_Hs01_00189486 predicted 1007
10 SASI_Hs01_00189487 predicted 916
11 SASI_Hs01_00189483 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049406 predicted 316
2 SASI_Rn01_00049407 predicted 586
3 SASI_Rn01_00049408 predicted 330
4 SASI_Rn01_00049409 predicted 332
5 SASI_Rn01_00049410 predicted 455
6 SASI_Rn01_00049412 predicted 192
7 SASI_Rn01_00049413 predicted 332
8 SASI_Rn01_00049414 predicted 403
9 SASI_Rn01_00049415 predicted 443
10 SASI_Rn02_00198090 predicted 272
11 SASI_Rn01_00049411 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176970 predicted 671
2 SASI_Mm02_00342840 predicted 418
3 SASI_Mm01_00176971 predicted 531
4 SASI_Mm01_00176972 predicted 424
5 SASI_Mm01_00176973 predicted 818
6 SASI_Mm01_00176974 predicted 225
7 SASI_Mm01_00176975 predicted 350
8 SASI_Mm02_00342841 predicted 429
9 SASI_Mm01_00176976 predicted 293
10 SASI_Mm01_00176978 predicted 396
11 SASI_Mm01_00176977 predicted 553
12 SASI_Mm01_00176979 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152922
EGFL8 MISSION shRNA Bacterial Glycerol Stock
EGF-like-domain, multiple 8
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-155s1c1
Sequence:CCGGCCTATAGTCAACCGGTGTACACTCGAGTGTACACCGGTTGACTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-30s1c1
Sequence:CCGGCCTACGAGGACTCTCATTCTTCTCGAGAAGAATGAGAGTCCTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-206s1c1
Sequence:CCGGGCATATGTAGCACCTACAGGACTCGAGTCCTGTAGGTGCTACATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-339s1c1
Sequence:CCGGCTGCTCCAAGCCTTGTCTTAACTCGAGTTAAGACAAGGCTTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152922
EGFL8 MISSION shRNA shRNA Plasmid DNA
EGF-like-domain, multiple 8
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-155s1c1
Sequence:CCGGCCTATAGTCAACCGGTGTACACTCGAGTGTACACCGGTTGACTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-30s1c1
Sequence:CCGGCCTACGAGGACTCTCATTCTTCTCGAGAAGAATGAGAGTCCTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-206s1c1
Sequence:CCGGGCATATGTAGCACCTACAGGACTCGAGTCCTGTAGGTGCTACATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-339s1c1
Sequence:CCGGCTGCTCCAAGCCTTGTCTTAACTCGAGTTAAGACAAGGCTTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152922
EGFL8 MISSION shRNA Lentiviral Transduction Particles
EGF-like-domain, multiple 8
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-155s1c1
Sequence:CCGGCCTATAGTCAACCGGTGTACACTCGAGTGTACACCGGTTGACTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-30s1c1
Sequence:CCGGCCTACGAGGACTCTCATTCTTCTCGAGAAGAATGAGAGTCCTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-206s1c1
Sequence:CCGGGCATATGTAGCACCTACAGGACTCGAGTCCTGTAGGTGCTACATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152922.1-339s1c1
Sequence:CCGGCTGCTCCAAGCCTTGTCTTAACTCGAGTTAAGACAAGGCTTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030652
VALIDATED
EGFL8 MISSION shRNA Bacterial Glycerol Stock
EGF-like-domain, multiple 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-213s1c1
Sequence:CCGGCAGCACTTACAGGACCATGTACTCGAGTACATGGTCCTGTAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-43s1c1
Sequence:CCGGTCCTTCCTCCTGCTACTGATACTCGAGTATCAGTAGCAGGAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-421s1c1
Sequence:CCGGTGTCATGTGGACGTGGATGAACTCGAGTTCATCCACGTCCACATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-138s1c1
Sequence:CCGGGCTCCACTACAACGAGTCCTACTCGAGTAGGACTCGTTGTAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030652.1-625s1c1
Sequence:CCGGCGCGCTCTGAAGCAGGAGATTCTCGAGAATCTCCTGCTTCAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-517s21c1
Sequence:CCGGCCTCTGCTCGCACCATTGTTTCTCGAGAAACAATGGTGCGAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-920s21c1
Sequence:CCGGCTCGGCGTCAATCATCGATAACTCGAGTTATCGATGATTGACGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-230s21c1
Sequence:CCGGTACAAGCCCTACCTGACCTTGCTCGAGCAAGGTCAGGTAGGGCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-630s21c1
Sequence:CCGGCAACCAGTGCCAGCATACTCACTCGAGTGAGTATGCTGGCACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030652.2-976s21c1
Sequence:CCGGCAGAAACCGGACCCACTAATCCTCGAGGATTAGTGGGTCCGGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030652
VALIDATED
EGFL8 MISSION shRNA shRNA Plasmid DNA
EGF-like-domain, multiple 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-213s1c1
Sequence:CCGGCAGCACTTACAGGACCATGTACTCGAGTACATGGTCCTGTAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-43s1c1
Sequence:CCGGTCCTTCCTCCTGCTACTGATACTCGAGTATCAGTAGCAGGAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-421s1c1
Sequence:CCGGTGTCATGTGGACGTGGATGAACTCGAGTTCATCCACGTCCACATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-138s1c1
Sequence:CCGGGCTCCACTACAACGAGTCCTACTCGAGTAGGACTCGTTGTAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030652.1-625s1c1
Sequence:CCGGCGCGCTCTGAAGCAGGAGATTCTCGAGAATCTCCTGCTTCAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-517s21c1
Sequence:CCGGCCTCTGCTCGCACCATTGTTTCTCGAGAAACAATGGTGCGAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-920s21c1
Sequence:CCGGCTCGGCGTCAATCATCGATAACTCGAGTTATCGATGATTGACGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-230s21c1
Sequence:CCGGTACAAGCCCTACCTGACCTTGCTCGAGCAAGGTCAGGTAGGGCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-630s21c1
Sequence:CCGGCAACCAGTGCCAGCATACTCACTCGAGTGAGTATGCTGGCACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030652.2-976s21c1
Sequence:CCGGCAGAAACCGGACCCACTAATCCTCGAGGATTAGTGGGTCCGGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030652
VALIDATED
EGFL8 MISSION shRNA Lentiviral Transduction Particles
EGF-like-domain, multiple 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-213s1c1
Sequence:CCGGCAGCACTTACAGGACCATGTACTCGAGTACATGGTCCTGTAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-43s1c1
Sequence:CCGGTCCTTCCTCCTGCTACTGATACTCGAGTATCAGTAGCAGGAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-421s1c1
Sequence:CCGGTGTCATGTGGACGTGGATGAACTCGAGTTCATCCACGTCCACATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030652.1-138s1c1
Sequence:CCGGGCTCCACTACAACGAGTCCTACTCGAGTAGGACTCGTTGTAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030652.1-625s1c1
Sequence:CCGGCGCGCTCTGAAGCAGGAGATTCTCGAGAATCTCCTGCTTCAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-517s21c1
Sequence:CCGGCCTCTGCTCGCACCATTGTTTCTCGAGAAACAATGGTGCGAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-920s21c1
Sequence:CCGGCTCGGCGTCAATCATCGATAACTCGAGTTATCGATGATTGACGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-230s21c1
Sequence:CCGGTACAAGCCCTACCTGACCTTGCTCGAGCAAGGTCAGGTAGGGCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030652.2-630s21c1
Sequence:CCGGCAACCAGTGCCAGCATACTCACTCGAGTGAGTATGCTGGCACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030652.2-976s21c1
Sequence:CCGGCAGAAACCGGACCCACTAATCCTCGAGGATTAGTGGGTCCGGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks