EMAIL THIS PAGE TO A FRIEND

EGFLAM

EGF-like, fibronectin type III and laminin G domains

179 Gene Product Result for
Synonyms: AGRINL AGRNL
Gene ID:
Mouse(268780) EGF-like, fibronectin type III and laminin G domains
Rat(365691) EGF-like, fibronectin type III and laminin G domains
sheep(101106626) EGF-like, fibronectin type III and laminin G domains
Domestic Rabbit(100349755) EGF-like, fibronectin type III and laminin G domains
naked mole-rat(101698974) EGF-like, fibronectin type III and laminin G domains
domestic guinea pig(100716729) EGF-like, fibronectin type III and laminin G domains
Zebrafish(100535036) EGF-like, fibronectin type III and laminin G domains
chicken(427445) EGF-like, fibronectin type III and laminin G domains
domestic cat(101097453) EGF-like, fibronectin type III and laminin G domains
cow(534427) EGF-like, fibronectin type III and laminin G domains
Horse(100053309) EGF-like, fibronectin type III and laminin G domains
dog(479359) EGF-like, fibronectin type III and laminin G domains
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152403 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152403 Rosetta Predictions human pricing
NM_182798 Rosetta Predictions human pricing
NM_182799 Rosetta Predictions human pricing
NM_182801 Rosetta Predictions human pricing
NM_001108938 Rosetta Predictions rat pricing
NM_178748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211096 predicted 3220
2 SASI_Hs01_00211097 predicted 3156
3 SASI_Hs01_00211098 predicted 3327
4 SASI_Hs01_00211099 predicted 3275
5 SASI_Hs01_00211100 predicted 3201
6 SASI_Hs01_00211101 predicted 3079
7 SASI_Hs01_00211102 predicted 3079
8 SASI_Hs01_00211103 predicted 3223
9 SASI_Hs02_00366088 predicted 3023
10 SASI_Hs01_00211104 predicted 3208
11 SASI_Hs01_00211105 predicted 3215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025727 predicted 2536
2 SASI_Hs01_00025728 predicted 2466
3 SASI_Hs01_00025729 predicted 2647
4 SASI_Hs01_00025730 predicted 2590
5 SASI_Hs01_00025731 predicted 2515
6 SASI_Hs01_00025732 predicted 2385
7 SASI_Hs01_00025733 predicted 2397
8 SASI_Hs01_00025734 predicted 2540
9 SASI_Hs02_00370947 predicted 2344
10 SASI_Hs01_00025735 predicted 2521
11 SASI_Hs01_00025736 predicted 2534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103047 predicted 1697
2 SASI_Hs01_00103048 predicted 1633
3 SASI_Hs01_00103049 predicted 1814
4 SASI_Hs01_00103050 predicted 1755
5 SASI_Hs01_00103051 predicted 1683
6 SASI_Hs01_00103052 predicted 1553
7 SASI_Hs01_00103053 predicted 1564
8 SASI_Hs01_00103054 predicted 1711
9 SASI_Hs02_00370948 predicted 1503
10 SASI_Hs01_00103055 predicted 1689
11 SASI_Hs01_00103056 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114546 predicted 596
2 SASI_Hs01_00114547 predicted 531
3 SASI_Hs01_00114548 predicted 716
4 SASI_Hs01_00114549 predicted 663
5 SASI_Hs01_00114550 predicted 584
6 SASI_Hs01_00114551 predicted 458
7 SASI_Hs01_00114552 predicted 460
8 SASI_Hs01_00114553 predicted 611
9 SASI_Hs02_00370951 predicted 403
10 SASI_Hs01_00114554 predicted 589
11 SASI_Hs01_00114555 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243564 predicted 1934
2 SASI_Rn02_00243565 predicted 2298
3 SASI_Rn02_00243566 predicted 2816
4 SASI_Rn02_00243567 predicted 751
5 SASI_Rn02_00243568 predicted 3308
6 SASI_Rn02_00243569 predicted 2488
7 SASI_Rn02_00243570 predicted 2450
8 SASI_Rn02_00243571 predicted 3248
9 SASI_Rn02_00243572 predicted 826
10 SASI_Rn02_00243573 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074602 predicted 3179
2 SASI_Mm01_00074603 predicted 1960
3 SASI_Mm01_00074604 predicted 2329
4 SASI_Mm01_00074605 predicted 2533
5 SASI_Mm02_00349285 predicted 1426
6 SASI_Mm01_00074606 predicted 2527
7 SASI_Mm01_00074607 predicted 2843
8 SASI_Mm01_00074608 predicted 865
9 SASI_Mm01_00074609 predicted 3331
10 SASI_Mm01_00074610 predicted 770
11 SASI_Mm01_00074611 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152403
EGFLAM MISSION shRNA Bacterial Glycerol Stock
EGF-like, fibronectin type III and laminin G domains
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-2227s21c1
Sequence:CCGGATGGAATTTGAGATCACATTTCTCGAGAAATGTGATCTCAAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-1122s21c1
Sequence:CCGGCGACTTAGATTTGGATATTTCCTCGAGGAAATATCCAAATCTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-2801s21c1
Sequence:CCGGCCATTGAGATCCCGCAGTTTACTCGAGTAAACTGCGGGATCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-1460s1c1
Sequence:CCGGGCTGCTCAGAAGATATTGTTACTCGAGTAACAATATCTTCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-879s1c1
Sequence:CCGGCGACAAGAAGTGGACCTCAATCTCGAGATTGAGGTCCACTTCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-3222s1c1
Sequence:CCGGGCACACTAACAGGCAATATATCTCGAGATATATTGCCTGTTAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152403
EGFLAM MISSION shRNA shRNA Plasmid DNA
EGF-like, fibronectin type III and laminin G domains
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-2227s21c1
Sequence:CCGGATGGAATTTGAGATCACATTTCTCGAGAAATGTGATCTCAAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-1122s21c1
Sequence:CCGGCGACTTAGATTTGGATATTTCCTCGAGGAAATATCCAAATCTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-2801s21c1
Sequence:CCGGCCATTGAGATCCCGCAGTTTACTCGAGTAAACTGCGGGATCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-1460s1c1
Sequence:CCGGGCTGCTCAGAAGATATTGTTACTCGAGTAACAATATCTTCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-879s1c1
Sequence:CCGGCGACAAGAAGTGGACCTCAATCTCGAGATTGAGGTCCACTTCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-3222s1c1
Sequence:CCGGGCACACTAACAGGCAATATATCTCGAGATATATTGCCTGTTAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152403
EGFLAM MISSION shRNA Lentiviral Transduction Particles
EGF-like, fibronectin type III and laminin G domains
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-2227s21c1
Sequence:CCGGATGGAATTTGAGATCACATTTCTCGAGAAATGTGATCTCAAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-1122s21c1
Sequence:CCGGCGACTTAGATTTGGATATTTCCTCGAGGAAATATCCAAATCTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152403.2-2801s21c1
Sequence:CCGGCCATTGAGATCCCGCAGTTTACTCGAGTAAACTGCGGGATCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-1460s1c1
Sequence:CCGGGCTGCTCAGAAGATATTGTTACTCGAGTAACAATATCTTCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-879s1c1
Sequence:CCGGCGACAAGAAGTGGACCTCAATCTCGAGATTGAGGTCCACTTCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152403.2-3222s1c1
Sequence:CCGGGCACACTAACAGGCAATATATCTCGAGATATATTGCCTGTTAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178748
EGFLAM MISSION shRNA Bacterial Glycerol Stock
EGF-like, fibronectin type III and laminin G domains
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178748.3-3735s1c1
Sequence:CCGGCCTGAACTTCATACTTCCAATCTCGAGATTGGAAGTATGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-2735s1c1
Sequence:CCGGCTGACGTATGACAACCCAAATCTCGAGATTTGGGTTGTCATACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-1411s1c1
Sequence:CCGGCGTAACCTTTGAGCCTCTGAACTCGAGTTCAGAGGCTCAAAGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-2734s1c1
Sequence:CCGGCCTGACGTATGACAACCCAAACTCGAGTTTGGGTTGTCATACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-845s1c1
Sequence:CCGGCCAGATACCAACTACCAGTTTCTCGAGAAACTGGTAGTTGGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178748
EGFLAM MISSION shRNA shRNA Plasmid DNA
EGF-like, fibronectin type III and laminin G domains
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178748.3-3735s1c1
Sequence:CCGGCCTGAACTTCATACTTCCAATCTCGAGATTGGAAGTATGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-2735s1c1
Sequence:CCGGCTGACGTATGACAACCCAAATCTCGAGATTTGGGTTGTCATACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-1411s1c1
Sequence:CCGGCGTAACCTTTGAGCCTCTGAACTCGAGTTCAGAGGCTCAAAGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-2734s1c1
Sequence:CCGGCCTGACGTATGACAACCCAAACTCGAGTTTGGGTTGTCATACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-845s1c1
Sequence:CCGGCCAGATACCAACTACCAGTTTCTCGAGAAACTGGTAGTTGGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178748
EGFLAM MISSION shRNA Lentiviral Transduction Particles
EGF-like, fibronectin type III and laminin G domains
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178748.3-3735s1c1
Sequence:CCGGCCTGAACTTCATACTTCCAATCTCGAGATTGGAAGTATGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-2735s1c1
Sequence:CCGGCTGACGTATGACAACCCAAATCTCGAGATTTGGGTTGTCATACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-1411s1c1
Sequence:CCGGCGTAACCTTTGAGCCTCTGAACTCGAGTTCAGAGGCTCAAAGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-2734s1c1
Sequence:CCGGCCTGACGTATGACAACCCAAACTCGAGTTTGGGTTGTCATACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178748.3-845s1c1
Sequence:CCGGCCAGATACCAACTACCAGTTTCTCGAGAAACTGGTAGTTGGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks