EMAIL THIS PAGE TO A FRIEND

EGFR

epidermal growth factor receptor

262 Gene Product Result for
Synonyms: ERBB ERBB1 HER1 PIG61 mENA
Gene ID:
Human(1956) Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(13649) epidermal growth factor receptor
Rat(24329) epidermal growth factor receptor
fruit fly(37455) Epidermal growth factor receptor
cow(407217) epidermal growth factor receptor
Horse(100067755) epidermal growth factor receptor
domestic cat(100510799) epidermal growth factor receptor
dog(404306) epidermal growth factor receptor
chicken(396494) epidermal growth factor receptor
domestic guinea pig(100725363) epidermal growth factor receptor
naked mole-rat(101723771) epidermal growth factor receptor
sheep(780479) epidermal growth factor receptor
Gene Class: Apoptosis, Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E2906 Anti-dEGF Receptor, Extracellular Domain antibody, Mouse monoclonal clone C-273, purified from hybridoma cell culture Drosophila
ELISA, immunohistochemistry, western blot pricing
SAB4300352 Anti-EGFR (Ab-1070) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300353 Anti-EGFR (Ab-1092) antibody produced in rabbit affinity isolated antibody rat, human
immunohistochemistry, western blot pricing
SAB4300510 Anti-EGFR (Ab-1110) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300472 Anti-EGFR (Ab-1172) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300602 Anti-EGFR (Ab-1197) antibody produced in goat affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300480 Anti-EGFR (Ab-1197) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300453 Anti-EGFR (Ab-678) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4300454 Anti-EGFR (Ab-693) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4300481 Anti-EGFR (Ab-869) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
GW21146 Anti-EGFR antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB1405746 Anti-EGFR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA001200 Anti-EGFR antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA018530 Anti-EGFR antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500711 Anti-EGFR antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4500712 Anti-EGFR antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500720 Anti-EGFR antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5500096 Anti-EGFR antibody, Rabbit monoclonal clone SP84, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB5500097 Anti-EGFR antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP9, tissue culture supernatant human (tested)
flow cytometry, immunohistochemistry pricing
SAB4500713 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500714 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4500715 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4500716 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4500717 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4500718 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500719 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500721 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500722 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500723 Anti-EGFR, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
E1282 Anti-Epidermal Growth Factor Receptor antibody produced in goat affinity isolated antibody, lyophilized powder mouse
immunohistochemistry, western blot pricing
A204 Anti-Epidermal Growth Factor Receptor antibody produced in sheep IgG fraction of antiserum, buffered aqueous solution rat, dog, human, chicken
immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
E1157 Anti-Epidermal Growth Factor Receptor/Erb B1 antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, flow cytometry, immunoprecipitation, western blot pricing
SAB4504579 Anti-phospho-EGFR (pSer1026) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301402 Anti-phospho-EGFR (pSer1026) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300062 Anti-phospho-EGFR (pSer1070) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504382 Anti-phospho-EGFR (pSer1070) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504580 Anti-phospho-EGFR (pSer1071) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301574 Anti-phospho-EGFR (pSer1071) antibody produced in rabbit affinity isolated antibody human, rat
western blot pricing
SAB4504578 Anti-phospho-EGFR (pSer695) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301573 Anti-phospho-EGFR (pSer695) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4300151 Anti-phospho-EGFR (pThr678) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4503759 Anti-phospho-EGFR (pThr678) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4300152 Anti-phospho-EGFR (pThr693) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4503760 Anti-phospho-EGFR (pThr693) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503909 Anti-phospho-EGFR (pTyr1016) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301509 Anti-phospho-EGFR (pTyr1016) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4504170 Anti-phospho-EGFR (pTyr1069) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4300063 Anti-phospho-EGFR (pTyr1092) antibody produced in rabbit affinity isolated antibody rat, human
immunohistochemistry, western blot pricing
SAB4504383 Anti-phospho-EGFR (pTyr1092) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300209 Anti-phospho-EGFR (pTyr1110) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4504384 Anti-phospho-EGFR (pTyr1110) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300177 Anti-phospho-EGFR (pTyr1172) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4504385 Anti-phospho-EGFR (pTyr1172) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300285 Anti-phospho-EGFR (pTyr1197) antibody produced in goat affinity isolated antibody rat, mouse, human
western blot pricing
SAB4300183 Anti-phospho-EGFR (pTyr1197) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4504386 Anti-phospho-EGFR (pTyr1197) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300184 Anti-phospho-EGFR (pTyr869) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4504387 Anti-phospho-EGFR (pTyr869) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
E6154 Anti-phospho-Epidermal Growth Factor Receptor (pTyr1068) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human
western blot pricing
E1530 Anti-phospho-Epidermal Growth Factor Receptor (pTyr1086) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
western blot pricing
E6279 Anti-phospho-Epidermal Growth Factor Receptor (pTyr1173) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human, chicken, mouse
western blot pricing
E6029 Anti-phospho-Epidermal Growth Factor Receptor (pTyr845) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunocytochemistry, western blot pricing
E0907 Anti-phospho-Epidermal Growth Factor Receptor (pTyr845) antibody produced in rabbit affinity isolated antibody, lyophilized powder human
flow cytometry, immunohistochemistry, western blot pricing
E1780 Anti-phospho-Epidermal Growth Factor Receptor (pTyr992) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat (predicted), chicken (predicted), mouse (predicted), human
western blot pricing
E1655 Anti-phospho-Epidermal Growth Factor Receptor [pTyr1148] antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
E3031 Monoclonal Anti-dEGF Receptor, Cytoplasmic Domain antibody produced in mouse ~1.5 mg/mL, clone E-257, purified immunoglobulin, buffered aqueous solution Drosophila
ELISA, immunohistochemistry, western blot pricing
E2156 Monoclonal Anti-EGF Receptor antibody produced in mouse clone 225, purified from hybridoma cell culture human
immunoprecipitation pricing
WH0001956M2 Monoclonal Anti-EGFR antibody produced in mouse clone 4H2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
AMAB90816 Monoclonal Anti-EGFR antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0815, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90819 Monoclonal Anti-EGFR antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0822, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
E2760 Monoclonal Anti-Epidermal Growth Factor Receptor antibody produced in mouse clone 29.1, ascites fluid mouse, pig, human, rat, canine
ELISA, western blot pricing
E3138 Monoclonal Anti-Epidermal Growth Factor Receptor antibody produced in mouse clone F4, ascites fluid human
ELISA, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
E0532 Monoclonal Anti-Epidermal Growth Factor Receptor antibody produced in mouse clone 102618, purified immunoglobulin, lyophilized powder human
western blot pricing
E0782 Monoclonal Anti-Epidermal Growth Factor Receptor antibody produced in rat clone 176436, purified immunoglobulin, lyophilized powder mouse
flow cytometry, western blot pricing
E0657 Monoclonal Anti-phospho-Epidermal Growth Factor Receptor (pTyr1068) antibody produced in mouse clone 338324, purified immunoglobulin, lyophilized powder human
flow cytometry, western blot pricing
PLA0101 Rabbit anti-EGFR Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. marmoset, human, chimpanzee, gibbon, rhesus monkey, gorilla
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP3028 EGF-receptor human recombinant, expressed in CHO cells, ≥95% (SDS-PAGE), ≥95% (HPLC), cell culture tested human pricing
SRP5023 EGFR (695-end), active, GST tagged human PRECISIO® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP0240 EGFR (L858R) Active human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE) human pricing
SRP5325 EGFR (L861Q), active, GST tagged human PRECISIO®, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP0242 EGFR (T790M L858R) Active human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE) human pricing
SRP0241 EGFR (T790M) Active human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE) human pricing
SRP0239 EGFR Active human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE) human pricing
SRP6404 EGFR/ErbB1 human recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE) human pricing
E3641 Epidermal Growth Factor Receptor human buffered aqueous glycerol solution, 5,000-30,000 units/mg protein (Lowry) human pricing
E2645 Epidermal Growth Factor Receptor human lyophilized powder, ≥15,000 units/mg protein (Bradford) human pricing
APREST78873 PrEST Antigen EGFR Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
APREST78874 PrEST Antigen EGFR Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22429 SILuPrEST EGFR SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22430 SILuPrEST EGFR SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
SRP0344 EGFR active mouse recombinant, expressed in baculovirus infected Sf9 cells mouse pricing
SRP6409 ErbB1/EGFR from mouse recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE) mouse pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0094 AQUA Peptide GSTAENAE(pY)L[R] human pricing
AQ0731 AQUA Peptide NYVVTDHGSCV[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005228 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
06-847 Anti-EGFR Antibody 200 µg, Anti-EGFR Antibody detects level of EGFR & has been published & validated for use in IP & WB. pricing
MABF120 Anti-EGFR Antibody, clone 225 (Azide-free) 100 µg, Anti-EGFR Antibody, clone 225 (Azide-free) is an antibody against EGFR for use in Immunoprecipitation, Neutralizing. pricing
MABF119 Anti-EGFR Antibody, clone 528 (Azide-free) 100 µg, Anti-EGFR Antibody, clone 528 (Azide-free) detects level of EGFR & has been published & validated for use in Immunoprecipitation, Neutralizing. pricing
MABS835 Anti-EGFR Antibody, clone 7F12.1 50 μg, Detect EGFR using this mouse monoclonal , Cat. No. MABS835, validated for use in Flow Cytometry, Immunocytochemistry, and Western Blotting. pricing
05-104 Anti-EGFR Antibody, clone LA22 250 µg, Anti-EGFR Antibody, clone LA22 is an antibody against EGFR for use in IC, IP & WB. pricing
05-101 Anti-EGFR Antibody, neutralizing, clone LA1 250 µg, Detect EGFR using this Anti-EGFR Antibody, neutralizing, clone LA1 validated for use in IC, IP, NEUT & WB. pricing
16-246 Anti-EGFR Antibody, neutralizing, clone LA1, Alexa Fluor® 488 125 µg, This Anti-EGFR Antibody, neutralizing, clone LA1, Alexa Fluor 488 is validated for use in IF for the detection of EGFR. pricing
16-247 Anti-EGFR Antibody, neutralizing, clone LA1, Alexa Fluor® 555 125 µg, Anti-EGFR Antibody, neutralizing, clone LA1, Alexa Fluor 555 is an antibody against EGFR for use in FC & IC. pricing
04-290 Anti-EGFR (CT) Antibody, clone 13G8 100 µg, Anti-EGFR (C-terminus) Antibody, clone 13G8 detects level of EGFR (C-terminus) & has been published & validated for use in ELISA, IC & WB. pricing
05-1047 Anti-EGFR (cytoplasmic domain) Antibody, clone 8G6.2 100 µg, Detect EGFR (cytoplasmic domain) using this Anti-EGFR (cytoplasmic domain) Antibody, clone 8G6.2 validated for use in IC, IH, IP & WB. pricing
05-484 Anti-EGFR (non-phospho-Tyr1173) Antibody, clone 20G3 100 µg, Detect EGFR (non-phospho-Tyr1173) using this Anti-EGFR (non-phospho-Tyr1173) Antibody, clone 20G3 validated for use in IP & WB. pricing
04-282 Anti-phospho-EGFR (Thr654) Antibody, clone 3F2 100 µg, Detect phospho-EGFR (Thr654) using this Anti-phospho-EGFR (Thr654) Antibody, clone 3F2 validated for use in ELISA, IP & WB. pricing
04-281 Anti-phospho-EGFR (Thr669) Antibody, clone 5F10 100 µg, Anti-phospho-EGFR (Thr669) Antibody, clone 5F10 detects level of phospho-EGFR (Thr669) & has been published & validated for use in WB. pricing
07-715 Anti-phospho-EGFR (Tyr1069) Antibody 100 µL, Detect phospho-EGFR (Tyr1069) using this Anti-phospho-EGFR (Tyr1069) Antibody validated for use in IP & WB. pricing
07-818 Anti-phospho-EGFR (Tyr1086) Antibody 100 µL, Anti-phospho-EGFR (Tyr1086) Antibody detects level of phospho-EGFR (Tyr1086) & has been published & validated for use in WB. pricing
07-819 Anti-phospho-EGFR (Tyr1148) Antibody 100 µL, This Anti-phospho-EGFR (Tyr1148) Antibody is validated for use in WB for the detection of phospho-EGFR (Tyr1148). pricing
MABS829 Anti-phospho-EGFR (Tyr1173) Antibody, clone 3E7.2 100 µL, Detect phospho EGFR using this mouse monoclonal Anti-phospho-EGFR (Tyr1173), clone 3E7.2, Cat. No. MABS829, used in Immunocytochemistry and Western Blotting. pricing
05-483 Anti-phospho-EGFR (Tyr1173) Antibody, clone 9H2 100 µg, Anti-phospho-EGFR (Tyr1173) Antibody, clone 9H2 detects level of phospho-EGFR (Tyr1173) & has been published & validated for use in ELISA, IC, IP & WB. pricing
16-244 Anti-phospho-EGFR (Tyr1173) Antibody, clone 9H2, Alexa Fluor® 488 25 µg, Anti-phospho-EGFR (Tyr1173) Antibody, clone 9H2, Alexa Fluor 488 detects level of phospho-EGFR (Tyr1173) & has been published & validated for use in FC & IC. pricing
07-820 Anti-phospho-EGFR (Tyr845) Antibody 100 µL, This Anti-phospho-EGFR (Tyr845) Antibody is validated for use in IC, IF, IH, WB for the detection of phospho-EGFR (Tyr845). pricing
04-283 Anti-phospho-EGFR (Tyr845) Antibody, clone 12A3 100 µg, Detect phospho-EGFR (Tyr845) using this Anti-phospho-EGFR (Tyr845) Antibody, clone 12A3 validated for use in ELISA, IC, IP & WB. pricing
14-626-M EGFR (L858R) Protein, active, 250 µg 250 µg, Active, N-terminal GST-tagged, recombinant human EGF Receptor, amino acids 696-end containing the mutation L858R, for use in Enzyme Assays. pricing
14-627-M EGFR (L861Q) Protein, active, 10 µg 10 µg, Active, N-terminal GST-tagged, recombinant human EGF Receptor, amino acids 696-end containing the mutation L861Q, for use in Enzyme Assays. pricing
14-531-M EGFR Protein, active, 10 µg 10 µg, Active, N-terminal GST-tagged human EGFR kinase domain, amino acids 696-end, for use in Enzyme Assays. pricing
14-721-M EGFR (T790M, L858R) Protein, active, 10 µg 10 µg, Active, N-terminal GST-tagged, recombinant human EGFR, amino acids 696-end containing the mutations T790M & L858R, for use in Enzyme Assays. pricing
14-725-M EGFR (T790M) Protein, active, 10 µg 10 µg, Active, N-terminal GST-tagged recombinant human EGF Receptor, amino acids 696end containing the mutation T790M, for use in Enzyme Assays. pricing
FCABS254F Milli-Mark™ Anti-EGFR-FITC Antibody 100 tests, Milli-Mark Anti-EGFR-FITC Antibody is an antibody against EGFR for use in FC. pricing
FCMAB129CP Milli-Mark Anti-EGFR-PerCP Antibody, clone LA22 100 tests, Milli-Mark Anti-EGFR-PerCP Antibody, clone LA22 detects level of EGFR & has been published & validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005228 Rosetta Predictions human pricing
NM_201282 Rosetta Predictions human pricing
NM_201283 Rosetta Predictions human pricing
NM_201284 Rosetta Predictions human pricing
NM_031507 Rosetta Predictions rat pricing
NM_007912 Rosetta Predictions mouse pricing
NM_207655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215449 predicted 567
2 SASI_Hs01_00215450 predicted 444
3 SASI_Hs01_00215451 predicted 734
4 SASI_Hs01_00215452 predicted 462
5 SASI_Hs01_00215453 predicted 720
6 SASI_Hs01_00215454 predicted 645
7 SASI_Hs01_00215455 predicted 1097
8 SASI_Hs01_00215456 predicted 646
9 SASI_Hs02_00339216 predicted 1058
10 SASI_Hs02_00339217 predicted 1056
11 SASI_Hs01_00215447 predicted 646
12 SASI_Hs01_00215448 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010279 predicted 568
2 SASI_Hs01_00010280 predicted 445
3 SASI_Hs01_00010281 predicted 735
4 SASI_Hs01_00010282 predicted 467
5 SASI_Hs01_00010283 predicted 719
6 SASI_Hs01_00010284 predicted 644
7 SASI_Hs01_00010285 predicted 1096
8 SASI_Hs01_00010286 predicted 647
9 SASI_Hs02_00372918 predicted 1064
10 SASI_Hs02_00372919 predicted 1063
11 SASI_Hs01_00010277 predicted 646
12 SASI_Hs01_00010278 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084812 predicted 563
2 SASI_Hs01_00084813 predicted 444
3 SASI_Hs01_00084814 predicted 734
4 SASI_Hs01_00084815 predicted 463
5 SASI_Hs01_00084816 predicted 720
6 SASI_Hs01_00084817 predicted 651
7 SASI_Hs01_00084818 predicted 1095
8 SASI_Hs01_00084819 predicted 649
9 SASI_Hs02_00372920 predicted 1062
10 SASI_Hs02_00372921 predicted 1062
11 SASI_Hs01_00084810 predicted 641
12 SASI_Hs01_00084811 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115270 predicted 567
2 SASI_Hs01_00115271 predicted 449
3 SASI_Hs01_00115272 predicted 734
4 SASI_Hs01_00115273 predicted 459
5 SASI_Hs01_00115274 predicted 727
6 SASI_Hs01_00115275 predicted 645
7 SASI_Hs01_00115276 predicted 1093
8 SASI_Hs01_00115277 predicted 646
9 SASI_Hs02_00372922 predicted 1065
10 SASI_Hs02_00372923 predicted 1062
11 SASI_Hs01_00115268 predicted 639
12 SASI_Hs01_00115269 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081670 predicted 2813
2 SASI_Rn01_00081671 predicted 914
3 SASI_Rn01_00081672 predicted 1549
4 SASI_Rn01_00081673 predicted 227
5 SASI_Rn01_00081674 predicted 556
6 SASI_Rn01_00081675 predicted 1149
7 SASI_Rn02_00264632 predicted 1884
8 SASI_Rn01_00081676 predicted 2964
9 SASI_Rn01_00081678 predicted 3345
10 SASI_Rn01_00081679 predicted 512
11 SASI_Rn01_00081677 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101666 predicted 1097
2 SASI_Mm01_00101668 predicted 1531
3 SASI_Mm01_00101669 predicted 656
4 SASI_Mm01_00101671 predicted 1284
5 SASI_Mm01_00101672 predicted 356
6 SASI_Mm02_00312723 predicted 536
7 SASI_Mm01_00101673 predicted 371
8 SASI_Mm01_00101674 predicted 1275
9 SASI_Mm01_00101675 predicted 1161
10 SASI_Mm02_00312724 predicted 1330
11 SASI_Mm01_00101667 predicted 1660
12 SASI_Mm01_00101670 predicted 1678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156603 predicted 1094
2 SASI_Mm01_00156605 predicted 1532
3 SASI_Mm01_00156606 predicted 659
4 SASI_Mm01_00156608 predicted 1279
5 SASI_Mm01_00156609 predicted 358
6 SASI_Mm02_00352175 predicted 535
7 SASI_Mm01_00156610 predicted 378
8 SASI_Mm01_00156611 predicted 1278
9 SASI_Mm01_00156612 predicted 1168
10 SASI_Mm02_00352176 predicted 1336
11 SASI_Mm01_00156604 predicted 1665
12 SASI_Mm01_00156607 predicted 1678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005228
VALIDATED
EGFR MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor
Human
30 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2874s1c1
Sequence:CCGGGCCTATCAAGTGGATGGCATTCTCGAGAATGCCATCCACTTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2346s1c1
Sequence:CCGGCCAAGCTCTCTTGAGGATCTTCTCGAGAAGATCCTCAAGAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3557s1c1
Sequence:CCGGCTGTGCAGAATCCTGTCTATCCTCGAGGATAGACAGGATTCTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.x-1166s1c1
Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005228.3-4725s1c1
Sequence:CCGGCATTGGATTCATCAGCATTTGCTCGAGCAAATGCTGATGAATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-1411s1c1
Sequence:CCGGCCACAGGAACTGGATATTCTGCTCGAGCAGAATATCCAGTTCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1216s1c1
Sequence:CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2467s1c1
Sequence:CCGGCCCGTCGCTATCAAGGAATTACTCGAGTAATTCCTTGATAGCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039633    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-4682s1c1
Sequence:CCGGGCTGAGAATGTGGAATACCTACTCGAGTAGGTATTCCACATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005228.3-5399s1c1
Sequence:CCGGCCCATCCAATTTATCAAGGAACTCGAGTTCCTTGATAAATTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1292s1c1
Sequence:CCGGTCTCCATAAATGCTACGAATACTCGAGTATTCGTAGCATTTATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2791s1c1
Sequence:CCGGCAGCATGTCAAGATCACAGATCTCGAGATCTGTGATCTTGACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1575s1c1
Sequence:CCGGGAACATAACATCCTTGGGATTCTCGAGAATCCCAAGGATGTTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-5329s1c1
Sequence:CCGGCCCTGTAACCTGACTGGTTAACTCGAGTTAACCAGTCAGGTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-4888s1c1
Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-3383s1c1
Sequence:CCGGCCGTGGCTTGCATTGATAGAACTCGAGTTCTATCAATGCAAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-3732s1c1
Sequence:CCGGCCACCAAATTAGCCTGGACAACTCGAGTTGTCCAGGCTAATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-1246s1c1
Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3849s1c1
Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3787s1c1
Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-568s1c1
Sequence:CCGGAGAGGAAATATGTACTACGAACTCGAGTTCGTAGTACATATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-396s1c1
Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-2650s1c1
Sequence:CCGGGTCCGGGAACACAAAGACAATCTCGAGATTGTCTTTGTGTTCCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-499s1c1
Sequence:CCGGGTGGCTGGTTATGTCCTCATTCTCGAGAATGAGGACATAACCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.x-4705s1c1
Sequence:CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3849s21c1
Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-4888s21c1
Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-396s21c1
Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3095s21c1
Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3787s21c1
Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005228
VALIDATED
EGFR MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor
Human
30 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2874s1c1
Sequence:CCGGGCCTATCAAGTGGATGGCATTCTCGAGAATGCCATCCACTTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2346s1c1
Sequence:CCGGCCAAGCTCTCTTGAGGATCTTCTCGAGAAGATCCTCAAGAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3557s1c1
Sequence:CCGGCTGTGCAGAATCCTGTCTATCCTCGAGGATAGACAGGATTCTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.x-1166s1c1
Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005228.3-4725s1c1
Sequence:CCGGCATTGGATTCATCAGCATTTGCTCGAGCAAATGCTGATGAATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-1411s1c1
Sequence:CCGGCCACAGGAACTGGATATTCTGCTCGAGCAGAATATCCAGTTCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1216s1c1
Sequence:CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2467s1c1
Sequence:CCGGCCCGTCGCTATCAAGGAATTACTCGAGTAATTCCTTGATAGCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039633    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-4682s1c1
Sequence:CCGGGCTGAGAATGTGGAATACCTACTCGAGTAGGTATTCCACATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005228.3-5399s1c1
Sequence:CCGGCCCATCCAATTTATCAAGGAACTCGAGTTCCTTGATAAATTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1292s1c1
Sequence:CCGGTCTCCATAAATGCTACGAATACTCGAGTATTCGTAGCATTTATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2791s1c1
Sequence:CCGGCAGCATGTCAAGATCACAGATCTCGAGATCTGTGATCTTGACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1575s1c1
Sequence:CCGGGAACATAACATCCTTGGGATTCTCGAGAATCCCAAGGATGTTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-5329s1c1
Sequence:CCGGCCCTGTAACCTGACTGGTTAACTCGAGTTAACCAGTCAGGTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-4888s1c1
Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-3383s1c1
Sequence:CCGGCCGTGGCTTGCATTGATAGAACTCGAGTTCTATCAATGCAAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-3732s1c1
Sequence:CCGGCCACCAAATTAGCCTGGACAACTCGAGTTGTCCAGGCTAATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-1246s1c1
Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3849s1c1
Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3787s1c1
Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-568s1c1
Sequence:CCGGAGAGGAAATATGTACTACGAACTCGAGTTCGTAGTACATATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-396s1c1
Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-2650s1c1
Sequence:CCGGGTCCGGGAACACAAAGACAATCTCGAGATTGTCTTTGTGTTCCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-499s1c1
Sequence:CCGGGTGGCTGGTTATGTCCTCATTCTCGAGAATGAGGACATAACCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.x-4705s1c1
Sequence:CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3849s21c1
Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-4888s21c1
Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-396s21c1
Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3095s21c1
Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3787s21c1
Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005228
VALIDATED
EGFR MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor
Human
30 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2874s1c1
Sequence:CCGGGCCTATCAAGTGGATGGCATTCTCGAGAATGCCATCCACTTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2346s1c1
Sequence:CCGGCCAAGCTCTCTTGAGGATCTTCTCGAGAAGATCCTCAAGAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3557s1c1
Sequence:CCGGCTGTGCAGAATCCTGTCTATCCTCGAGGATAGACAGGATTCTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.x-1166s1c1
Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005228.3-4725s1c1
Sequence:CCGGCATTGGATTCATCAGCATTTGCTCGAGCAAATGCTGATGAATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-1411s1c1
Sequence:CCGGCCACAGGAACTGGATATTCTGCTCGAGCAGAATATCCAGTTCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1216s1c1
Sequence:CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2467s1c1
Sequence:CCGGCCCGTCGCTATCAAGGAATTACTCGAGTAATTCCTTGATAGCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039633    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-4682s1c1
Sequence:CCGGGCTGAGAATGTGGAATACCTACTCGAGTAGGTATTCCACATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005228.3-5399s1c1
Sequence:CCGGCCCATCCAATTTATCAAGGAACTCGAGTTCCTTGATAAATTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1292s1c1
Sequence:CCGGTCTCCATAAATGCTACGAATACTCGAGTATTCGTAGCATTTATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-2791s1c1
Sequence:CCGGCAGCATGTCAAGATCACAGATCTCGAGATCTGTGATCTTGACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-1575s1c1
Sequence:CCGGGAACATAACATCCTTGGGATTCTCGAGAATCCCAAGGATGTTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-5329s1c1
Sequence:CCGGCCCTGTAACCTGACTGGTTAACTCGAGTTAACCAGTCAGGTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-4888s1c1
Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-3383s1c1
Sequence:CCGGCCGTGGCTTGCATTGATAGAACTCGAGTTCTATCAATGCAAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-3732s1c1
Sequence:CCGGCCACCAAATTAGCCTGGACAACTCGAGTTGTCCAGGCTAATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-1246s1c1
Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3849s1c1
Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.3-3787s1c1
Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-568s1c1
Sequence:CCGGAGAGGAAATATGTACTACGAACTCGAGTTCGTAGTACATATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-396s1c1
Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005228.3-2650s1c1
Sequence:CCGGGTCCGGGAACACAAAGACAATCTCGAGATTGTCTTTGTGTTCCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005228.3-499s1c1
Sequence:CCGGGTGGCTGGTTATGTCCTCATTCTCGAGAATGAGGACATAACCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005228.x-4705s1c1
Sequence:CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3849s21c1
Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-4888s21c1
Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-396s21c1
Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3095s21c1
Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005228.3-3787s21c1
Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207655
EGFR MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-3135s1c1
Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-2117s1c1
Sequence:CCGGGCCAATAATGTCTGCCACCTACTCGAGTAGGTGGCAGACATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-2914s1c1
Sequence:CCGGGCCTATCAAGTGGATGGCTTTCTCGAGAAAGCCATCCACTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-1296s1c1
Sequence:CCGGGCATAGGCATTGGTGAATTTACTCGAGTAAATTCACCAATGCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-3822s1c1
Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-1694s21c1
Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-3135s21c1
Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-3822s21c1
Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-1535s21c1
Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207655
EGFR MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-3135s1c1
Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-2117s1c1
Sequence:CCGGGCCAATAATGTCTGCCACCTACTCGAGTAGGTGGCAGACATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-2914s1c1
Sequence:CCGGGCCTATCAAGTGGATGGCTTTCTCGAGAAAGCCATCCACTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-1296s1c1
Sequence:CCGGGCATAGGCATTGGTGAATTTACTCGAGTAAATTCACCAATGCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-3822s1c1
Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-1694s21c1
Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-3135s21c1
Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-3822s21c1
Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-1535s21c1
Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207655
EGFR MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-3135s1c1
Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-2117s1c1
Sequence:CCGGGCCAATAATGTCTGCCACCTACTCGAGTAGGTGGCAGACATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-2914s1c1
Sequence:CCGGGCCTATCAAGTGGATGGCTTTCTCGAGAAAGCCATCCACTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-1296s1c1
Sequence:CCGGGCATAGGCATTGGTGAATTTACTCGAGTAAATTCACCAATGCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207655.1-3822s1c1
Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-1694s21c1
Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-3135s21c1
Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-3822s21c1
Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207655.2-1535s21c1
Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007912
EGFR MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-745s1c1
Sequence:CCGGCCTCTGCAATATGGATACTATCTCGAGATAGTATCCATATTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-1694s1c1
Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-643s1c1
Sequence:CCGGCCTGTCCAACTATGGGACAAACTCGAGTTTGTCCCATAGTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-2218s1c1
Sequence:CCGGGCAGTGGATCTTAAAGACCTTCTCGAGAAGGTCTTTAAGATCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-1535s1c1
Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007912
EGFR MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-745s1c1
Sequence:CCGGCCTCTGCAATATGGATACTATCTCGAGATAGTATCCATATTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-1694s1c1
Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-643s1c1
Sequence:CCGGCCTGTCCAACTATGGGACAAACTCGAGTTTGTCCCATAGTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-2218s1c1
Sequence:CCGGGCAGTGGATCTTAAAGACCTTCTCGAGAAGGTCTTTAAGATCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-1535s1c1
Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007912
EGFR MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-745s1c1
Sequence:CCGGCCTCTGCAATATGGATACTATCTCGAGATAGTATCCATATTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-1694s1c1
Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-643s1c1
Sequence:CCGGCCTGTCCAACTATGGGACAAACTCGAGTTTGTCCCATAGTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-2218s1c1
Sequence:CCGGGCAGTGGATCTTAAAGACCTTCTCGAGAAGGTCTTTAAGATCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007912.1-1535s1c1
Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks