EMAIL THIS PAGE TO A FRIEND

EGLN1

egl-9 family hypoxia-inducible factor 1

119 Gene Product Result for
Synonyms: C1orf12 ECYT3 HIF-PH2 HIFPH2 HPH-2 HPH2 PHD2 SM20 ZMYND6
UniProtKB ID: Q9GZT9, Q8N3M8, Q9BZS8, Q9BZT0
Gene ID:
Human(54583) Summary: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). [provided by RefSeq, Nov 2009]
Mouse(112405) EGL nine homolog 1 (C. elegans)
Rat(308913) EGL nine homolog 1 (C. elegans)
Zebrafish(436868) egl nine homolog 1 (C. elegans)
cow(534075) egl nine homolog 1 (C. elegans)
domestic cat(101089964) egl nine homolog 1 (C. elegans)
dog(488971) egl nine homolog 1 (C. elegans)
sheep(101114163) egl nine homolog 1 (C. elegans)
naked mole-rat(101709882) egl nine homolog 1 (C. elegans)
domestic guinea pig(100726309) egl nine homolog 1 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34608 Anti-EGLN1 antibody produced in rabbit IgG fraction of antiserum guinea pig, canine, mouse, rat, rabbit, zebrafish, human, horse,
western blot pricing
HPA022129 Anti-EGLN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022051 Rosetta Predictions human pricing
NM_178334 Rosetta Predictions rat pricing
NM_053207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355408 predicted 4485
2 SASI_Hs02_00355409 predicted 4072
3 SASI_Hs02_00355410 predicted 4273
4 SASI_Hs01_00172483 predicted 3911
5 SASI_Hs02_00355411 predicted 4162
6 SASI_Hs02_00355412 predicted 4284
7 SASI_Hs01_00172488 predicted 4475
8 SASI_Hs02_00355413 predicted 4067
9 SASI_Hs02_00355414 predicted 4296
10 SASI_Hs02_00355415 predicted 4496
11 SASI_Hs01_00172481 predicted 4126
12 SASI_Hs01_00172482 predicted 4113
13 SASI_Hs01_00172484 predicted 4131
14 SASI_Hs01_00172485 predicted 4123
15 SASI_Hs01_00172486 predicted 4130
16 SASI_Hs01_00172487 predicted 4116
17 SASI_Hs01_00172489 predicted 4129
18 SASI_Hs01_00172490 predicted 4402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088429 predicted 754
2 SASI_Rn01_00088430 predicted 542
3 SASI_Rn01_00088431 predicted 525
4 SASI_Rn01_00088432 predicted 985
5 SASI_Rn01_00088433 predicted 1121
6 SASI_Rn01_00088435 predicted 746
7 SASI_Rn01_00088436 predicted 991
8 SASI_Rn01_00088437 predicted 659
9 SASI_Rn01_00088438 predicted 882
10 SASI_Rn02_00269642 predicted 1165
11 SASI_Rn01_00088434 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337785 predicted 1050
2 SASI_Mm01_00186127 predicted 1262
3 SASI_Mm02_00337786 predicted 1484
4 SASI_Mm02_00337787 predicted 1002
5 SASI_Mm01_00186128 predicted 1230
6 SASI_Mm02_00337788 predicted 1068
7 SASI_Mm02_00337789 predicted 1087
8 SASI_Mm02_00337790 predicted 958
9 SASI_Mm01_00186131 predicted 1419
10 SASI_Mm02_00337791 predicted 1085
11 SASI_Mm01_00186125 predicted 288
12 SASI_Mm01_00186126 predicted 377
13 SASI_Mm01_00186129 predicted 262
14 SASI_Mm01_00186130 predicted 488
15 SASI_Mm01_00186132 predicted 426
16 SASI_Mm01_00186133 predicted 521
17 SASI_Mm01_00186134 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022051
VALIDATED
EGLN1 MISSION shRNA Bacterial Glycerol Stock
egl-9 family hypoxia-inducible factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-4110s21c1
Sequence:CCGGTGGAGATGGAAGATGTGTGACCTCGAGGTCACACATCTTCCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022051.1-4747s21c1
Sequence:CCGGCTGTTATCTAGCTGAGTTCATCTCGAGATGAACTCAGCTAGATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-3996s21c1
Sequence:CCGGACGCCACTGTAACGGGAAGCTCTCGAGAGCTTCCCGTTACAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-3985s21c1
Sequence:CCGGGACGACCTGATACGCCACTGTCTCGAGACAGTGGCGTATCAGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3842s1c1
Sequence:CCGGTGCACGACACCGGGAAGTTCACTCGAGTGAACTTCCCGGTGTCGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-4110s1c1
Sequence:CCGGTGGAGATGGAAGATGTGTGACCTCGAGGTCACACATCTTCCATCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3996s1c1
Sequence:CCGGACGCCACTGTAACGGGAAGCTCTCGAGAGCTTCCCGTTACAGTGGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3985s1c1
Sequence:CCGGGACGACCTGATACGCCACTGTCTCGAGACAGTGGCGTATCAGGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-4747s1c1
Sequence:CCGGCTGTTATCTAGCTGAGTTCATCTCGAGATGAACTCAGCTAGATAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022051
VALIDATED
EGLN1 MISSION shRNA shRNA Plasmid DNA
egl-9 family hypoxia-inducible factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-4110s21c1
Sequence:CCGGTGGAGATGGAAGATGTGTGACCTCGAGGTCACACATCTTCCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022051.1-4747s21c1
Sequence:CCGGCTGTTATCTAGCTGAGTTCATCTCGAGATGAACTCAGCTAGATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-3996s21c1
Sequence:CCGGACGCCACTGTAACGGGAAGCTCTCGAGAGCTTCCCGTTACAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-3985s21c1
Sequence:CCGGGACGACCTGATACGCCACTGTCTCGAGACAGTGGCGTATCAGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3842s1c1
Sequence:CCGGTGCACGACACCGGGAAGTTCACTCGAGTGAACTTCCCGGTGTCGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-4110s1c1
Sequence:CCGGTGGAGATGGAAGATGTGTGACCTCGAGGTCACACATCTTCCATCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3996s1c1
Sequence:CCGGACGCCACTGTAACGGGAAGCTCTCGAGAGCTTCCCGTTACAGTGGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3985s1c1
Sequence:CCGGGACGACCTGATACGCCACTGTCTCGAGACAGTGGCGTATCAGGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-4747s1c1
Sequence:CCGGCTGTTATCTAGCTGAGTTCATCTCGAGATGAACTCAGCTAGATAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022051
VALIDATED
EGLN1 MISSION shRNA Lentiviral Transduction Particles
egl-9 family hypoxia-inducible factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-4110s21c1
Sequence:CCGGTGGAGATGGAAGATGTGTGACCTCGAGGTCACACATCTTCCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022051.1-4747s21c1
Sequence:CCGGCTGTTATCTAGCTGAGTTCATCTCGAGATGAACTCAGCTAGATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-3996s21c1
Sequence:CCGGACGCCACTGTAACGGGAAGCTCTCGAGAGCTTCCCGTTACAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022051.1-3985s21c1
Sequence:CCGGGACGACCTGATACGCCACTGTCTCGAGACAGTGGCGTATCAGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3842s1c1
Sequence:CCGGTGCACGACACCGGGAAGTTCACTCGAGTGAACTTCCCGGTGTCGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-4110s1c1
Sequence:CCGGTGGAGATGGAAGATGTGTGACCTCGAGGTCACACATCTTCCATCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3996s1c1
Sequence:CCGGACGCCACTGTAACGGGAAGCTCTCGAGAGCTTCCCGTTACAGTGGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-3985s1c1
Sequence:CCGGGACGACCTGATACGCCACTGTCTCGAGACAGTGGCGTATCAGGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022051.x-4747s1c1
Sequence:CCGGCTGTTATCTAGCTGAGTTCATCTCGAGATGAACTCAGCTAGATAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053207
VALIDATED
EGLN1 MISSION shRNA Bacterial Glycerol Stock
egl-9 family hypoxia-inducible factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1065s21c1
Sequence:CCGGCGTCACGTTGATAACCCAAATCTCGAGATTTGGGTTATCAACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1316s21c1
Sequence:CCGGGCGAGCGAGAGCTAAAGTAAACTCGAGTTTACTTTAGCTCTCGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1137s21c1
Sequence:CCGGGCCAAGGTAAGTGGAGGTATTCTCGAGAATACCTCCACTTACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1283s21c1
Sequence:CCGGCGCAATAACTGTTTGGTATTTCTCGAGAAATACCAAACAGTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-283s1c1
Sequence:CCGGCGCAATAACTGTTTGGTATTTCTCGAGAAATACCAAACAGTTATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-316s1c1
Sequence:CCGGGCGAGCGAGAGCTAAAGTAAACTCGAGTTTACTTTAGCTCTCGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-137s1c1
Sequence:CCGGGCCAAGGTAAGTGGAGGTATTCTCGAGAATACCTCCACTTACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-1079s1c1
Sequence:CCGGGCACTCAACTAACTCAACATACTCGAGTATGTTGAGTTAGTTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-65s1c1
Sequence:CCGGCGTCACGTTGATAACCCAAATCTCGAGATTTGGGTTATCAACGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053207
VALIDATED
EGLN1 MISSION shRNA shRNA Plasmid DNA
egl-9 family hypoxia-inducible factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1065s21c1
Sequence:CCGGCGTCACGTTGATAACCCAAATCTCGAGATTTGGGTTATCAACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1316s21c1
Sequence:CCGGGCGAGCGAGAGCTAAAGTAAACTCGAGTTTACTTTAGCTCTCGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1137s21c1
Sequence:CCGGGCCAAGGTAAGTGGAGGTATTCTCGAGAATACCTCCACTTACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1283s21c1
Sequence:CCGGCGCAATAACTGTTTGGTATTTCTCGAGAAATACCAAACAGTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-283s1c1
Sequence:CCGGCGCAATAACTGTTTGGTATTTCTCGAGAAATACCAAACAGTTATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-316s1c1
Sequence:CCGGGCGAGCGAGAGCTAAAGTAAACTCGAGTTTACTTTAGCTCTCGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-137s1c1
Sequence:CCGGGCCAAGGTAAGTGGAGGTATTCTCGAGAATACCTCCACTTACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-1079s1c1
Sequence:CCGGGCACTCAACTAACTCAACATACTCGAGTATGTTGAGTTAGTTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-65s1c1
Sequence:CCGGCGTCACGTTGATAACCCAAATCTCGAGATTTGGGTTATCAACGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053207
VALIDATED
EGLN1 MISSION shRNA Lentiviral Transduction Particles
egl-9 family hypoxia-inducible factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1065s21c1
Sequence:CCGGCGTCACGTTGATAACCCAAATCTCGAGATTTGGGTTATCAACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1316s21c1
Sequence:CCGGGCGAGCGAGAGCTAAAGTAAACTCGAGTTTACTTTAGCTCTCGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1137s21c1
Sequence:CCGGGCCAAGGTAAGTGGAGGTATTCTCGAGAATACCTCCACTTACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053207.2-1283s21c1
Sequence:CCGGCGCAATAACTGTTTGGTATTTCTCGAGAAATACCAAACAGTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-283s1c1
Sequence:CCGGCGCAATAACTGTTTGGTATTTCTCGAGAAATACCAAACAGTTATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-316s1c1
Sequence:CCGGGCGAGCGAGAGCTAAAGTAAACTCGAGTTTACTTTAGCTCTCGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-137s1c1
Sequence:CCGGGCCAAGGTAAGTGGAGGTATTCTCGAGAATACCTCCACTTACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-1079s1c1
Sequence:CCGGGCACTCAACTAACTCAACATACTCGAGTATGTTGAGTTAGTTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053207.1-65s1c1
Sequence:CCGGCGTCACGTTGATAACCCAAATCTCGAGATTTGGGTTATCAACGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks