EMAIL THIS PAGE TO A FRIEND

EGLN2

egl-9 family hypoxia-inducible factor 2

117 Gene Product Result for
Synonyms: EIT6 HIF-PH1 HIFPH1 HPH-1 HPH-3 PHD1
UniProtKB ID: Q96KS0, A8K5S0, Q8WWY4, Q9BV14
Gene ID:
Human(112398) Summary: The hypoxia inducible factor (HIF) is a transcriptional complex that is involved in oxygen homeostasis. At normal oxygen levels, the alpha subunit of HIF is targeted for degration by prolyl hydroxylation. This gene encodes an enzyme responsible for this post-translational modification. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream RAB4B (RAB4B, member RAS oncogene family) gene. [provided by RefSeq, Feb 2011]
Mouse(112406) EGL nine homolog 2 (C. elegans)
Rat(308457) EGL nine homolog 2 (C. elegans)
domestic guinea pig(100726886) egl nine homolog 2 (C. elegans)
naked mole-rat(101704717) egl nine homolog 2 (C. elegans)
sheep(101120517) egl nine homolog 2 (C. elegans)
dog(484495) egl nine homolog 2 (C. elegans)
domestic cat(101090063) egl nine homolog 2 (C. elegans)
cow(536763) egl nine homolog 2 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080732 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002381 MISSION® esiRNA esiRNA targeting human EGLN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017555 Rosetta Predictions human pricing
NM_053046 Rosetta Predictions human pricing
NM_080732 Rosetta Predictions human pricing
NM_001004083 Rosetta Predictions rat pricing
NM_053208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113835 predicted 3275
2 SASI_Hs01_00113836 predicted 3284
3 SASI_Hs01_00113837 predicted 3316
4 SASI_Hs01_00113838 predicted 3354
5 SASI_Hs01_00113839 predicted 3348
6 SASI_Hs01_00113840 predicted 3351
7 SASI_Hs01_00113841 predicted 2901
8 SASI_Hs01_00113842 predicted 2695
9 SASI_Hs01_00113843 predicted 3208
10 SASI_Hs01_00113844 predicted 2844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361880 predicted 1215
2 SASI_Hs02_00361881 predicted 1396
3 SASI_Hs02_00361882 predicted 1454
4 SASI_Hs02_00361883 predicted 1026
5 SASI_Hs02_00361884 predicted 1150
6 SASI_Hs02_00361885 predicted 852
7 SASI_Hs02_00361886 predicted 1393
8 SASI_Hs02_00361887 predicted 732
9 SASI_Hs01_00124608 predicted 1513
10 SASI_Hs02_00361888 predicted 1439
11 SASI_Hs01_00124606 predicted 1467
12 SASI_Hs01_00124607 predicted 1485
13 SASI_Hs01_00124609 predicted 1823
14 SASI_Hs01_00124610 predicted 1654
15 SASI_Hs01_00124611 predicted 1556
16 SASI_Hs01_00124612 predicted 1539
17 SASI_Hs01_00124613 predicted 1836
18 SASI_Hs01_00124614 predicted 1776
19 SASI_Hs01_00124615 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362512 predicted 1273
2 SASI_Hs02_00362513 predicted 1450
3 SASI_Hs02_00362514 predicted 1511
4 SASI_Hs02_00362515 predicted 1092
5 SASI_Hs02_00362516 predicted 1209
6 SASI_Hs02_00362517 predicted 908
7 SASI_Hs02_00362518 predicted 1445
8 SASI_Hs02_00362519 predicted 789
9 SASI_Hs01_00035377 predicted 1571
10 SASI_Hs02_00362520 predicted 1497
11 SASI_Hs01_00035375 predicted 1431
12 SASI_Hs01_00035376 predicted 1437
13 SASI_Hs01_00035378 predicted 1789
14 SASI_Hs01_00035379 predicted 1613
15 SASI_Hs01_00035380 predicted 1512
16 SASI_Hs01_00035381 predicted 1502
17 SASI_Hs01_00035382 predicted 1800
18 SASI_Hs01_00035383 predicted 1734
19 SASI_Hs01_00035384 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118086 predicted 752
2 SASI_Rn01_00118087 predicted 1370
3 SASI_Rn01_00118088 predicted 1694
4 SASI_Rn01_00118090 predicted 1211
5 SASI_Rn02_00198117 predicted 1468
6 SASI_Rn01_00118092 predicted 762
7 SASI_Rn02_00198118 predicted 1439
8 SASI_Rn02_00198119 predicted 1629
9 SASI_Rn01_00118093 predicted 462
10 SASI_Rn01_00118094 predicted 394
11 SASI_Rn01_00118089 predicted 1394
12 SASI_Rn01_00118091 predicted 1455
13 SASI_Rn01_00118095 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154010 predicted 1721
2 SASI_Mm01_00154012 predicted 1382
3 SASI_Mm02_00337792 predicted 1407
4 SASI_Mm01_00154013 predicted 1219
5 SASI_Mm01_00154014 predicted 1460
6 SASI_Mm01_00154015 predicted 1498
7 SASI_Mm01_00154016 predicted 1453
8 SASI_Mm01_00154017 predicted 1735
9 SASI_Mm02_00337793 predicted 1402
10 SASI_Mm01_00154019 predicted 395
11 SASI_Mm01_00154011 predicted 1480
12 SASI_Mm01_00154018 predicted 1481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053208
VALIDATED
EGLN2 MISSION shRNA Bacterial Glycerol Stock
egl-9 family hypoxia-inducible factor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1767s1c1
Sequence:CCGGCGTTGAGTGTAGAGCTGAGAACTCGAGTTCTCAGCTCTACACTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1249s1c1
Sequence:CCGGGAATCAGAACTGGGATGTTAACTCGAGTTAACATCCCAGTTCTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053208.2-840s1c1
Sequence:CCGGCCCTGGACTATATTGTGCCTTCTCGAGAAGGCACAATATAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1319s1c1
Sequence:CCGGGCCAACATCGAGCCACTCTTTCTCGAGAAAGAGTGGCTCGATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053208.2-1118s1c1
Sequence:CCGGCTGGGCAACTACGTCATCAATCTCGAGATTGATGACGTAGTTGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1249s21c1
Sequence:CCGGGAATCAGAACTGGGATGTTAACTCGAGTTAACATCCCAGTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1489s21c1
Sequence:CCGGAGGTGTTCAAGTACCAGTATCCTCGAGGATACTGGTACTTGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1319s21c1
Sequence:CCGGGCCAACATCGAGCCACTCTTTCTCGAGAAAGAGTGGCTCGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053208.3-1767s21c1
Sequence:CCGGCGTTGAGTGTAGAGCTGAGAACTCGAGTTCTCAGCTCTACACTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053208
VALIDATED
EGLN2 MISSION shRNA shRNA Plasmid DNA
egl-9 family hypoxia-inducible factor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1767s1c1
Sequence:CCGGCGTTGAGTGTAGAGCTGAGAACTCGAGTTCTCAGCTCTACACTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1249s1c1
Sequence:CCGGGAATCAGAACTGGGATGTTAACTCGAGTTAACATCCCAGTTCTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053208.2-840s1c1
Sequence:CCGGCCCTGGACTATATTGTGCCTTCTCGAGAAGGCACAATATAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1319s1c1
Sequence:CCGGGCCAACATCGAGCCACTCTTTCTCGAGAAAGAGTGGCTCGATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053208.2-1118s1c1
Sequence:CCGGCTGGGCAACTACGTCATCAATCTCGAGATTGATGACGTAGTTGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1249s21c1
Sequence:CCGGGAATCAGAACTGGGATGTTAACTCGAGTTAACATCCCAGTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1489s21c1
Sequence:CCGGAGGTGTTCAAGTACCAGTATCCTCGAGGATACTGGTACTTGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1319s21c1
Sequence:CCGGGCCAACATCGAGCCACTCTTTCTCGAGAAAGAGTGGCTCGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053208.3-1767s21c1
Sequence:CCGGCGTTGAGTGTAGAGCTGAGAACTCGAGTTCTCAGCTCTACACTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053208
VALIDATED
EGLN2 MISSION shRNA Lentiviral Transduction Particles
egl-9 family hypoxia-inducible factor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1767s1c1
Sequence:CCGGCGTTGAGTGTAGAGCTGAGAACTCGAGTTCTCAGCTCTACACTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1249s1c1
Sequence:CCGGGAATCAGAACTGGGATGTTAACTCGAGTTAACATCCCAGTTCTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053208.2-840s1c1
Sequence:CCGGCCCTGGACTATATTGTGCCTTCTCGAGAAGGCACAATATAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053208.2-1319s1c1
Sequence:CCGGGCCAACATCGAGCCACTCTTTCTCGAGAAAGAGTGGCTCGATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053208.2-1118s1c1
Sequence:CCGGCTGGGCAACTACGTCATCAATCTCGAGATTGATGACGTAGTTGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1249s21c1
Sequence:CCGGGAATCAGAACTGGGATGTTAACTCGAGTTAACATCCCAGTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1489s21c1
Sequence:CCGGAGGTGTTCAAGTACCAGTATCCTCGAGGATACTGGTACTTGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053208.3-1319s21c1
Sequence:CCGGGCCAACATCGAGCCACTCTTTCTCGAGAAAGAGTGGCTCGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053208.3-1767s21c1
Sequence:CCGGCGTTGAGTGTAGAGCTGAGAACTCGAGTTCTCAGCTCTACACTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080732
VALIDATED
EGLN2 MISSION shRNA Bacterial Glycerol Stock
egl-9 family hypoxia-inducible factor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080732.1-1498s1c1
Sequence:CCGGCGCATGGCAGACAGCTTAAATCTCGAGATTTAAGCTGTCTGCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022328    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_080732.1-1208s1c1
Sequence:CCGGCTGGGACGTTAAGGTGCATGGCTCGAGCCATGCACCTTAACGTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080732.1-1174s1c1
Sequence:CCGGGCTGCATCACCTGTATCTATTCTCGAGAATAGATACAGGTGATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080732.1-1280s1c1
Sequence:CCGGGCCACTCTTTGACCGGTTGCTCTCGAGAGCAACCGGTCAAAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1304s21c1
Sequence:CCGGACTGGGACGTTAAGGTGCATGCTCGAGCATGCACCTTAACGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1377s21c1
Sequence:CCGGGCCACTCTTTGACCGGTTGCTCTCGAGAGCAACCGGTCAAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1271s21c1
Sequence:CCGGGCTGCATCACCTGTATCTATTCTCGAGAATAGATACAGGTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080732.2-1595s21c1
Sequence:CCGGCGCATGGCAGACAGCTTAAATCTCGAGATTTAAGCTGTCTGCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080732
VALIDATED
EGLN2 MISSION shRNA shRNA Plasmid DNA
egl-9 family hypoxia-inducible factor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080732.1-1498s1c1
Sequence:CCGGCGCATGGCAGACAGCTTAAATCTCGAGATTTAAGCTGTCTGCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022328    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_080732.1-1208s1c1
Sequence:CCGGCTGGGACGTTAAGGTGCATGGCTCGAGCCATGCACCTTAACGTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080732.1-1174s1c1
Sequence:CCGGGCTGCATCACCTGTATCTATTCTCGAGAATAGATACAGGTGATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080732.1-1280s1c1
Sequence:CCGGGCCACTCTTTGACCGGTTGCTCTCGAGAGCAACCGGTCAAAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1304s21c1
Sequence:CCGGACTGGGACGTTAAGGTGCATGCTCGAGCATGCACCTTAACGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1377s21c1
Sequence:CCGGGCCACTCTTTGACCGGTTGCTCTCGAGAGCAACCGGTCAAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1271s21c1
Sequence:CCGGGCTGCATCACCTGTATCTATTCTCGAGAATAGATACAGGTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080732.2-1595s21c1
Sequence:CCGGCGCATGGCAGACAGCTTAAATCTCGAGATTTAAGCTGTCTGCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080732
VALIDATED
EGLN2 MISSION shRNA Lentiviral Transduction Particles
egl-9 family hypoxia-inducible factor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080732.1-1498s1c1
Sequence:CCGGCGCATGGCAGACAGCTTAAATCTCGAGATTTAAGCTGTCTGCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022328    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_080732.1-1208s1c1
Sequence:CCGGCTGGGACGTTAAGGTGCATGGCTCGAGCCATGCACCTTAACGTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080732.1-1174s1c1
Sequence:CCGGGCTGCATCACCTGTATCTATTCTCGAGAATAGATACAGGTGATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080732.1-1280s1c1
Sequence:CCGGGCCACTCTTTGACCGGTTGCTCTCGAGAGCAACCGGTCAAAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1304s21c1
Sequence:CCGGACTGGGACGTTAAGGTGCATGCTCGAGCATGCACCTTAACGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1377s21c1
Sequence:CCGGGCCACTCTTTGACCGGTTGCTCTCGAGAGCAACCGGTCAAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080732.2-1271s21c1
Sequence:CCGGGCTGCATCACCTGTATCTATTCTCGAGAATAGATACAGGTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080732.2-1595s21c1
Sequence:CCGGCGCATGGCAGACAGCTTAAATCTCGAGATTTAAGCTGTCTGCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks