EMAIL THIS PAGE TO A FRIEND

EGLN3

egl-9 family hypoxia-inducible factor 3

188 Gene Product Result for
Synonyms: HIFP4H3 HIFPH3 PHD3
UniProtKB ID: Q9H6Z9, Q2TA79, Q3B8N4, Q6P1R2
Gene ID:
Mouse(112407) EGL nine homolog 3 (C. elegans)
Rat(54702) EGL nine homolog 3 (C. elegans)
Zebrafish(406602) egl nine homolog 3 (C. elegans)
chicken(423316) egl nine homolog 3 (C. elegans)
cow(535578) egl nine homolog 3 (C. elegans)
domestic cat(101082320) egl nine homolog 3 (C. elegans)
dog(480286) egl nine homolog 3 (C. elegans)
sheep(101117367) egl nine homolog 3 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022073 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022073 Rosetta Predictions human pricing
NM_019371 Rosetta Predictions rat pricing
NM_028133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244855 predicted 1020
2 SASI_Hs01_00244856 predicted 1227
3 SASI_Hs01_00244857 predicted 1235
4 SASI_Hs01_00244858 predicted 1302
5 SASI_Hs01_00244859 predicted 714
6 SASI_Hs02_00355439 predicted 764
7 SASI_Hs01_00244860 predicted 1134
8 SASI_Hs01_00244861 predicted 938
9 SASI_Hs02_00355440 predicted 1309
10 SASI_Hs01_00244862 predicted 927
11 SASI_Hs01_00244854 predicted 1218
12 SASI_Hs01_00244863 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078819 predicted 926
2 SASI_Rn01_00078821 predicted 998
3 SASI_Rn01_00078822 predicted 1229
4 SASI_Rn02_00262394 predicted 978
5 SASI_Rn01_00078823 predicted 1312
6 SASI_Rn01_00078824 predicted 1029
7 SASI_Rn01_00078825 predicted 920
8 SASI_Rn02_00262395 predicted 1028
9 SASI_Rn01_00078826 predicted 1259
10 SASI_Rn01_00078827 predicted 1301
11 SASI_Rn01_00078820 predicted 1320
12 SASI_Rn01_00078828 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070002 predicted 682
2 SASI_Mm01_00070003 predicted 1049
3 SASI_Mm01_00070004 predicted 664
4 SASI_Mm01_00070005 predicted 789
5 SASI_Mm01_00070006 predicted 727
6 SASI_Mm01_00070007 predicted 789
7 SASI_Mm01_00070008 predicted 753
8 SASI_Mm01_00070009 predicted 805
9 SASI_Mm01_00070010 predicted 678
10 SASI_Mm01_00070011 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028133
VALIDATED
EGLN3 MISSION shRNA Bacterial Glycerol Stock
egl-9 family hypoxia-inducible factor 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-372s21c1
Sequence:CCGGCGGCTTCTGCTACCTGGACAACTCGAGTTGTCCAGGTAGCAGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-1238s21c1
Sequence:CCGGCTAGCTGGCCAGCGGTTTAAACTCGAGTTTAAACCGCTGGCCAGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-912s21c1
Sequence:CCGGCGCTATGACTGTCTGGTACTTCTCGAGAAGTACCAGACAGTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-755s21c1
Sequence:CCGGAGAATTGGGACGCCAAGTTACCTCGAGGTAACTTGGCGTCCCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-912s1c1
Sequence:CCGGCGCTATGACTGTCTGGTACTTCTCGAGAAGTACCAGACAGTCATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028133.1-372s1c1
Sequence:CCGGCGGCTTCTGCTACCTGGACAACTCGAGTTGTCCAGGTAGCAGAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-618s1c1
Sequence:CCGGGCTGGGCAAATACTATGTCAACTCGAGTTGACATAGTATTTGCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-799s1c1
Sequence:CCGGCCGGAAGGGAAATCGTTTGTACTCGAGTACAAACGATTTCCCTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028133.1-1683s1c1
Sequence:CCGGGCCAGGTAGTTTGGGTTGTTTCTCGAGAAACAACCCAAACTACCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028133
VALIDATED
EGLN3 MISSION shRNA shRNA Plasmid DNA
egl-9 family hypoxia-inducible factor 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-372s21c1
Sequence:CCGGCGGCTTCTGCTACCTGGACAACTCGAGTTGTCCAGGTAGCAGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-1238s21c1
Sequence:CCGGCTAGCTGGCCAGCGGTTTAAACTCGAGTTTAAACCGCTGGCCAGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-912s21c1
Sequence:CCGGCGCTATGACTGTCTGGTACTTCTCGAGAAGTACCAGACAGTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-755s21c1
Sequence:CCGGAGAATTGGGACGCCAAGTTACCTCGAGGTAACTTGGCGTCCCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-912s1c1
Sequence:CCGGCGCTATGACTGTCTGGTACTTCTCGAGAAGTACCAGACAGTCATAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028133.1-372s1c1
Sequence:CCGGCGGCTTCTGCTACCTGGACAACTCGAGTTGTCCAGGTAGCAGAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-618s1c1
Sequence:CCGGGCTGGGCAAATACTATGTCAACTCGAGTTGACATAGTATTTGCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-799s1c1
Sequence:CCGGCCGGAAGGGAAATCGTTTGTACTCGAGTACAAACGATTTCCCTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028133.1-1683s1c1
Sequence:CCGGGCCAGGTAGTTTGGGTTGTTTCTCGAGAAACAACCCAAACTACCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028133
VALIDATED
EGLN3 MISSION shRNA Lentiviral Transduction Particles
egl-9 family hypoxia-inducible factor 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-372s21c1
Sequence:CCGGCGGCTTCTGCTACCTGGACAACTCGAGTTGTCCAGGTAGCAGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-1238s21c1
Sequence:CCGGCTAGCTGGCCAGCGGTTTAAACTCGAGTTTAAACCGCTGGCCAGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-912s21c1
Sequence:CCGGCGCTATGACTGTCTGGTACTTCTCGAGAAGTACCAGACAGTCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028133.1-755s21c1
Sequence:CCGGAGAATTGGGACGCCAAGTTACCTCGAGGTAACTTGGCGTCCCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-912s1c1
Sequence:CCGGCGCTATGACTGTCTGGTACTTCTCGAGAAGTACCAGACAGTCATAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028133.1-372s1c1
Sequence:CCGGCGGCTTCTGCTACCTGGACAACTCGAGTTGTCCAGGTAGCAGAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-618s1c1
Sequence:CCGGGCTGGGCAAATACTATGTCAACTCGAGTTGACATAGTATTTGCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028133.1-799s1c1
Sequence:CCGGCCGGAAGGGAAATCGTTTGTACTCGAGTACAAACGATTTCCCTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028133.1-1683s1c1
Sequence:CCGGGCCAGGTAGTTTGGGTTGTTTCTCGAGAAACAACCCAAACTACCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022073
VALIDATED
EGLN3 MISSION shRNA Bacterial Glycerol Stock
egl-9 family hypoxia-inducible factor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022073.3-1305s21c1
Sequence:CCGGTACCTGATAGATTCGGTAATACTCGAGTATTACCGAATCTATCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022073.3-764s21c1
Sequence:CCGGCACCTGCATCTACTATCTGAACTCGAGTTCAGATAGTAGATGCAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022073.3-810s21c1
Sequence:CCGGGGTGGGATCCTGCGGATATTTCTCGAGAAATATCCGCAGGATCCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022073.3-690s21c1
Sequence:CCGGGTGGCTTGCTATCCGGGAAATCTCGAGATTTCCCGGATAGCAAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022073.x-692s1c1
Sequence:CCGGGTGGCTTGCTATCCGGGAAATCTCGAGATTTCCCGGATAGCAAGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022073.x-652s1c1
Sequence:CCGGGCTGGGCAAATACTACGTCAACTCGAGTTGACGTAGTATTTGCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022073.x-664s1c1
Sequence:CCGGCTACGTCAAGGAGAGGTCTAACTCGAGTTAGACCTCTCCTTGACGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022073.x-766s1c1
Sequence:CCGGCACCTGCATCTACTATCTGAACTCGAGTTCAGATAGTAGATGCAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022073.x-2244s1c1
Sequence:CCGGCTTGGTATTGAGCACGTATTTCTCGAGAAATACGTGCTCAATACCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022073
VALIDATED
EGLN3 MISSION shRNA shRNA Plasmid DNA
egl-9 family hypoxia-inducible factor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022073.3-1305s21c1
Sequence:CCGGTACCTGATAGATTCGGTAATACTCGAGTATTACCGAATCTATCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022073.3-764s21c1
Sequence:CCGGCACCTGCATCTACTATCTGAACTCGAGTTCAGATAGTAGATGCAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022073.3-810s21c1
Sequence:CCGGGGTGGGATCCTGCGGATATTTCTCGAGAAATATCCGCAGGATCCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022073.3-690s21c1
Sequence:CCGGGTGGCTTGCTATCCGGGAAATCTCGAGATTTCCCGGATAGCAAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022073.x-692s1c1
Sequence:CCGGGTGGCTTGCTATCCGGGAAATCTCGAGATTTCCCGGATAGCAAGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022073.x-652s1c1
Sequence:CCGGGCTGGGCAAATACTACGTCAACTCGAGTTGACGTAGTATTTGCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022073.x-664s1c1
Sequence:CCGGCTACGTCAAGGAGAGGTCTAACTCGAGTTAGACCTCTCCTTGACGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022073.x-766s1c1
Sequence:CCGGCACCTGCATCTACTATCTGAACTCGAGTTCAGATAGTAGATGCAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022073.x-2244s1c1
Sequence:CCGGCTTGGTATTGAGCACGTATTTCTCGAGAAATACGTGCTCAATACCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022073
VALIDATED
EGLN3 MISSION shRNA Lentiviral Transduction Particles
egl-9 family hypoxia-inducible factor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022073.3-1305s21c1
Sequence:CCGGTACCTGATAGATTCGGTAATACTCGAGTATTACCGAATCTATCAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022073.3-764s21c1
Sequence:CCGGCACCTGCATCTACTATCTGAACTCGAGTTCAGATAGTAGATGCAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022073.3-810s21c1
Sequence:CCGGGGTGGGATCCTGCGGATATTTCTCGAGAAATATCCGCAGGATCCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022073.3-690s21c1
Sequence:CCGGGTGGCTTGCTATCCGGGAAATCTCGAGATTTCCCGGATAGCAAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022073.x-692s1c1
Sequence:CCGGGTGGCTTGCTATCCGGGAAATCTCGAGATTTCCCGGATAGCAAGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022073.x-652s1c1
Sequence:CCGGGCTGGGCAAATACTACGTCAACTCGAGTTGACGTAGTATTTGCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022073.x-664s1c1
Sequence:CCGGCTACGTCAAGGAGAGGTCTAACTCGAGTTAGACCTCTCCTTGACGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022073.x-766s1c1
Sequence:CCGGCACCTGCATCTACTATCTGAACTCGAGTTCAGATAGTAGATGCAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022073.x-2244s1c1
Sequence:CCGGCTTGGTATTGAGCACGTATTTCTCGAGAAATACGTGCTCAATACCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)