EMAIL THIS PAGE TO A FRIEND

EGR1

early growth response 1

175 Gene Product Result for
Synonyms: AT225 G0S30 KROX-24 NGFI-A TIS8 ZIF-268 ZNF225
UniProtKB ID: P18146
Gene ID:
Human(1958) Summary: The protein encoded by this gene belongs to the EGR family of C2H2-type zinc-finger proteins. It is a nuclear protein and functions as a transcriptional regulator. The products of target genes it activates are required for differentitation and mitogenesis. Studies suggest this is a cancer suppresor gene. [provided by RefSeq, Jul 2008]
Mouse(13653) early growth response 1
Rat(24330) early growth response 1
sheep(443547) early growth response 1
domestic guinea pig(100716298) early growth response 1
naked mole-rat(101714811) early growth response 1
Zebrafish(30498) early growth response 1
cow(407125) early growth response 1
Horse(100072574) early growth response 1
domestic cat(101088388) early growth response 1
dog(481528) early growth response 1
chicken(373931) early growth response 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412021 ANTI-EGR1 antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412535 ANTI-EGR1 antibody produced in mouse clone 2B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412536 ANTI-EGR1 antibody produced in mouse clone 6A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412560 ANTI-EGR1 antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412591 ANTI-EGR1 antibody produced in mouse clone 1F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412592 ANTI-EGR1 antibody produced in mouse clone 2H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107937 Anti-EGR1 antibody produced in rabbit IgG fraction of antiserum sheep, mouse, horse, rabbit, rat, bovine, canine, pig
immunohistochemistry, western blot pricing
AV32241 Anti-EGR1 antibody produced in rabbit affinity isolated antibody rabbit, human, bovine, horse, mouse, rat
western blot pricing
AV36841 Anti-EGR1 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder bovine, canine, mouse, rat
western blot pricing
SAB2105132 Anti-EGR1 antibody produced in rabbit affinity isolated antibody human, horse, sheep, rabbit, guinea pig
western blot pricing
HPA029937 Anti-EGR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA029938 Anti-EGR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105248 Anti-EGR1, (C-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, sheep, mouse
western blot pricing
SAB4500724 Anti-EGR1, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
WH0001958M3 Monoclonal Anti-EGR1 antibody produced in mouse clone 6E8, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunohistochemistry, western blot pricing
SAB5300487 Monoclonal Anti-EGR1 antibody produced in mouse clone 8A6, ascites fluid human
ELISA, western blot pricing
SAB1403758 Monoclonal Anti-EGR1, (C-terminal) antibody produced in mouse clone 3C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060821 MISSION® esiRNA esiRNA targeting mouse Egr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001964 Rosetta Predictions human pricing
NM_012551 Rosetta Predictions rat pricing
NM_007913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232227 predicted 849
2 SASI_Hs01_00232228 predicted 1175
3 SASI_Hs01_00232229 predicted 2153
4 SASI_Hs02_00332918 predicted 1180
5 SASI_Hs01_00232230 predicted 860
6 SASI_Hs01_00232232 predicted 2176
7 SASI_Hs01_00232233 predicted 1267
8 SASI_Hs01_00232235 predicted 2161
9 SASI_Hs02_00332919 predicted 856
10 SASI_Hs01_00232231 predicted 1194
11 SASI_Hs01_00232234 predicted 2146
12 SASI_Hs01_00232236 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050066 predicted 1018
2 SASI_Rn02_00259639 predicted 336
3 SASI_Rn02_00259640 predicted 921
4 SASI_Rn02_00259641 predicted 503
5 SASI_Rn02_00259642 predicted 921
6 SASI_Rn02_00259643 predicted 1141
7 SASI_Rn02_00259644 predicted 1254
8 SASI_Rn02_00259645 predicted 582
9 SASI_Rn02_00259646 predicted 843
10 SASI_Rn01_00050068 predicted 835
11 SASI_Rn01_00050067 predicted 1387
12 SASI_Rn01_00050069 predicted 1460
13 SASI_Rn01_00050070 predicted 1181
14 SASI_Rn01_00050071 predicted 1031
15 SASI_Rn01_00050072 predicted 1035
16 SASI_Rn01_00050073 predicted 1182
17 SASI_Rn01_00050074 predicted 1932
18 SASI_Rn01_00050075 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054023 predicted 1179
2 SASI_Mm01_00054024 predicted 1378
3 SASI_Mm01_00054025 predicted 1865
4 SASI_Mm01_00054026 predicted 1381
5 SASI_Mm01_00054027 predicted 1027
6 SASI_Mm01_00054028 predicted 1032
7 SASI_Mm01_00054029 predicted 1463
8 SASI_Mm01_00054030 predicted 1277
9 SASI_Mm01_00054031 predicted 1979
10 SASI_Mm01_00054032 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001964
EGR1 MISSION shRNA Bacterial Glycerol Stock
early growth response 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-591s1c1
Sequence:CCGGCATCTCTCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGAGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1464s1c1
Sequence:CCGGCGACATCTGTGGAAGAAAGTTCTCGAGAACTTTCTTCCACAGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1628s1c1
Sequence:CCGGCGGTTACTACCTCTTATCCATCTCGAGATGGATAAGAGGTAGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001964.2-2424s1c1
Sequence:CCGGGCCAAGCAAACCAATGGTGATCTCGAGATCACCATTGGTTTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1135s1c1
Sequence:CCGGCTGTCTACTATTAAGGCCTTTCTCGAGAAAGGCCTTAATAGTAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-591s21c1
Sequence:CCGGCATCTCTCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-899s21c1
Sequence:CCGGCCACGCCGAACACTGACATTTCTCGAGAAATGTCAGTGTTCGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-1464s21c1
Sequence:CCGGCGACATCTGTGGAAGAAAGTTCTCGAGAACTTTCTTCCACAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001964.2-2039s21c1
Sequence:CCGGTACTGGAGTGGAAGGTCTATTCTCGAGAATAGACCTTCCACTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001964
EGR1 MISSION shRNA shRNA Plasmid DNA
early growth response 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-591s1c1
Sequence:CCGGCATCTCTCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGAGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1464s1c1
Sequence:CCGGCGACATCTGTGGAAGAAAGTTCTCGAGAACTTTCTTCCACAGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1628s1c1
Sequence:CCGGCGGTTACTACCTCTTATCCATCTCGAGATGGATAAGAGGTAGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001964.2-2424s1c1
Sequence:CCGGGCCAAGCAAACCAATGGTGATCTCGAGATCACCATTGGTTTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1135s1c1
Sequence:CCGGCTGTCTACTATTAAGGCCTTTCTCGAGAAAGGCCTTAATAGTAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-591s21c1
Sequence:CCGGCATCTCTCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-899s21c1
Sequence:CCGGCCACGCCGAACACTGACATTTCTCGAGAAATGTCAGTGTTCGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-1464s21c1
Sequence:CCGGCGACATCTGTGGAAGAAAGTTCTCGAGAACTTTCTTCCACAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001964.2-2039s21c1
Sequence:CCGGTACTGGAGTGGAAGGTCTATTCTCGAGAATAGACCTTCCACTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001964
EGR1 MISSION shRNA Lentiviral Transduction Particles
early growth response 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-591s1c1
Sequence:CCGGCATCTCTCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGAGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1464s1c1
Sequence:CCGGCGACATCTGTGGAAGAAAGTTCTCGAGAACTTTCTTCCACAGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1628s1c1
Sequence:CCGGCGGTTACTACCTCTTATCCATCTCGAGATGGATAAGAGGTAGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001964.2-2424s1c1
Sequence:CCGGGCCAAGCAAACCAATGGTGATCTCGAGATCACCATTGGTTTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001964.2-1135s1c1
Sequence:CCGGCTGTCTACTATTAAGGCCTTTCTCGAGAAAGGCCTTAATAGTAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-591s21c1
Sequence:CCGGCATCTCTCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-899s21c1
Sequence:CCGGCCACGCCGAACACTGACATTTCTCGAGAAATGTCAGTGTTCGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001964.2-1464s21c1
Sequence:CCGGCGACATCTGTGGAAGAAAGTTCTCGAGAACTTTCTTCCACAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001964.2-2039s21c1
Sequence:CCGGTACTGGAGTGGAAGGTCTATTCTCGAGAATAGACCTTCCACTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007913
VALIDATED
EGR1 MISSION shRNA Bacterial Glycerol Stock
early growth response 1
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-2573s1c1
Sequence:CCGGCCCAGGACTTAAAGGCTCTTACTCGAGTAAGAGCCTTTAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007913.2-2587s1c1
Sequence:CCGGGCTCTTAATACCACCTACCAACTCGAGTTGGTAGGTGGTATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-1989s1c1
Sequence:CCGGCATCGCTCTGAATAATGAGAACTCGAGTTCTCATTATTCAGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-2428s1c1
Sequence:CCGGCCTGACTATCTGTTTCCACAACTCGAGTTGTGGAAACAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007913.2-2529s1c1
Sequence:CCGGCACTCCACTATCCACTATTAACTCGAGTTAATAGTGGATAGTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2131s21c1
Sequence:CCGGGACTTGATTTGCATGGTATTGCTCGAGCAATACCATGCAAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-654s21c1
Sequence:CCGGGTTGCCTCCCATCACCTATACCTCGAGGTATAGGTGATGGGAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2211s21c1
Sequence:CCGGGACCATCAAGTTGGCATAAAGCTCGAGCTTTATGCCAACTTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1332s21c1
Sequence:CCGGGGATGAGCTTACCCGCCATATCTCGAGATATGGCGGGTAAGCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1181s21c1
Sequence:CCGGAGGACTTAAAGGCTCTTAATACTCGAGTATTAAGAGCCTTTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007913.5-1134s21c1
Sequence:CCGGCACTCCACTATCCACTATTAACTCGAGTTAATAGTGGATAGTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007913.5-616s21c1
Sequence:CCGGGCGATGGTGGAGACGAGTTATCTCGAGATAACTCGTCTCCACCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-594s21c1
Sequence:CCGGCATCGCTCTGAATAATGAGAACTCGAGTTCTCATTATTCAGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2330s21c1
Sequence:CCGGGATAATTTGCATACTCTATTGCTCGAGCAATAGAGTATGCAAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1865s21c1
Sequence:CCGGGGACAATTGAAATTTGCTAAACTCGAGTTTAGCAAATTTCAATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-905s21c1
Sequence:CCGGCTACTCCCAACACTGACATTTCTCGAGAAATGTCAGTGTTGGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007913
VALIDATED
EGR1 MISSION shRNA shRNA Plasmid DNA
early growth response 1
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-2573s1c1
Sequence:CCGGCCCAGGACTTAAAGGCTCTTACTCGAGTAAGAGCCTTTAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007913.2-2587s1c1
Sequence:CCGGGCTCTTAATACCACCTACCAACTCGAGTTGGTAGGTGGTATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-1989s1c1
Sequence:CCGGCATCGCTCTGAATAATGAGAACTCGAGTTCTCATTATTCAGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-2428s1c1
Sequence:CCGGCCTGACTATCTGTTTCCACAACTCGAGTTGTGGAAACAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007913.2-2529s1c1
Sequence:CCGGCACTCCACTATCCACTATTAACTCGAGTTAATAGTGGATAGTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2131s21c1
Sequence:CCGGGACTTGATTTGCATGGTATTGCTCGAGCAATACCATGCAAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-654s21c1
Sequence:CCGGGTTGCCTCCCATCACCTATACCTCGAGGTATAGGTGATGGGAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2211s21c1
Sequence:CCGGGACCATCAAGTTGGCATAAAGCTCGAGCTTTATGCCAACTTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1332s21c1
Sequence:CCGGGGATGAGCTTACCCGCCATATCTCGAGATATGGCGGGTAAGCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1181s21c1
Sequence:CCGGAGGACTTAAAGGCTCTTAATACTCGAGTATTAAGAGCCTTTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007913.5-1134s21c1
Sequence:CCGGCACTCCACTATCCACTATTAACTCGAGTTAATAGTGGATAGTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007913.5-616s21c1
Sequence:CCGGGCGATGGTGGAGACGAGTTATCTCGAGATAACTCGTCTCCACCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-594s21c1
Sequence:CCGGCATCGCTCTGAATAATGAGAACTCGAGTTCTCATTATTCAGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2330s21c1
Sequence:CCGGGATAATTTGCATACTCTATTGCTCGAGCAATAGAGTATGCAAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1865s21c1
Sequence:CCGGGGACAATTGAAATTTGCTAAACTCGAGTTTAGCAAATTTCAATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-905s21c1
Sequence:CCGGCTACTCCCAACACTGACATTTCTCGAGAAATGTCAGTGTTGGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007913
VALIDATED
EGR1 MISSION shRNA Lentiviral Transduction Particles
early growth response 1
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-2573s1c1
Sequence:CCGGCCCAGGACTTAAAGGCTCTTACTCGAGTAAGAGCCTTTAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007913.2-2587s1c1
Sequence:CCGGGCTCTTAATACCACCTACCAACTCGAGTTGGTAGGTGGTATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-1989s1c1
Sequence:CCGGCATCGCTCTGAATAATGAGAACTCGAGTTCTCATTATTCAGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007913.2-2428s1c1
Sequence:CCGGCCTGACTATCTGTTTCCACAACTCGAGTTGTGGAAACAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007913.2-2529s1c1
Sequence:CCGGCACTCCACTATCCACTATTAACTCGAGTTAATAGTGGATAGTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2131s21c1
Sequence:CCGGGACTTGATTTGCATGGTATTGCTCGAGCAATACCATGCAAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-654s21c1
Sequence:CCGGGTTGCCTCCCATCACCTATACCTCGAGGTATAGGTGATGGGAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2211s21c1
Sequence:CCGGGACCATCAAGTTGGCATAAAGCTCGAGCTTTATGCCAACTTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1332s21c1
Sequence:CCGGGGATGAGCTTACCCGCCATATCTCGAGATATGGCGGGTAAGCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1181s21c1
Sequence:CCGGAGGACTTAAAGGCTCTTAATACTCGAGTATTAAGAGCCTTTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007913.5-1134s21c1
Sequence:CCGGCACTCCACTATCCACTATTAACTCGAGTTAATAGTGGATAGTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007913.5-616s21c1
Sequence:CCGGGCGATGGTGGAGACGAGTTATCTCGAGATAACTCGTCTCCACCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-594s21c1
Sequence:CCGGCATCGCTCTGAATAATGAGAACTCGAGTTCTCATTATTCAGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007913.5-2330s21c1
Sequence:CCGGGATAATTTGCATACTCTATTGCTCGAGCAATAGAGTATGCAAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-1865s21c1
Sequence:CCGGGGACAATTGAAATTTGCTAAACTCGAGTTTAGCAAATTTCAATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007913.5-905s21c1
Sequence:CCGGCTACTCCCAACACTGACATTTCTCGAGAAATGTCAGTGTTGGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks