EMAIL THIS PAGE TO A FRIEND

EGR2

early growth response 2

159 Gene Product Result for
Synonyms: AT591 CMT1D CMT4E KROX20
UniProtKB ID: P11161, B2R724, B3KRD7, Q68CZ5, Q8IV26, Q9UNA6
Gene ID:
Human(1959) Summary: The protein encoded by this gene is a transcription factor with three tandem C2H2-type zinc fingers. Defects in this gene are associated with Charcot-Marie-Tooth disease type 1D (CMT1D), Charcot-Marie-Tooth disease type 4E (CMT4E), and with Dejerine-Sottas syndrome (DSS). Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(13654) early growth response 2
Rat(114090) early growth response 2
dog(479219) early growth response 2
Horse(100062890) early growth response 2
cow(100297981) early growth response 2
domestic cat(101082520) early growth response 2
naked mole-rat(101712435) early growth response 2
domestic guinea pig(100721167) early growth response 2
sheep(101122407) early growth response 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000399 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000399 Rosetta Predictions human pricing
NM_053633 Rosetta Predictions rat pricing
NM_010118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170423 predicted 2134
2 SASI_Hs02_00302474 predicted 663
3 SASI_Hs01_00170425 predicted 2223
4 SASI_Hs01_00170426 predicted 585
5 SASI_Hs02_00302475 predicted 443
6 SASI_Hs01_00170427 predicted 620
7 SASI_Hs01_00170428 predicted 1530
8 SASI_Hs01_00170429 predicted 2137
9 SASI_Hs01_00170430 predicted 2125
10 SASI_Hs01_00170431 predicted 2224
11 SASI_Hs01_00170424 predicted 1583
12 SASI_Hs01_00170432 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056713 predicted 1525
2 SASI_Rn01_00056714 predicted 2045
3 SASI_Rn02_00266345 predicted 1564
4 SASI_Rn01_00056715 predicted 1579
5 SASI_Rn01_00056716 predicted 1536
6 SASI_Rn01_00056717 predicted 594
7 SASI_Rn01_00056718 predicted 889
8 SASI_Rn01_00056719 predicted 599
9 SASI_Rn01_00056720 predicted 1754
10 SASI_Rn01_00056721 predicted 814
11 SASI_Rn01_00056722 predicted 1751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084225 predicted 1143
2 SASI_Mm01_00084226 predicted 1933
3 SASI_Mm01_00084227 predicted 1384
4 SASI_Mm01_00084228 predicted 1591
5 SASI_Mm02_00317833 predicted 1762
6 SASI_Mm02_00317834 predicted 675
7 SASI_Mm01_00084229 predicted 1489
8 SASI_Mm01_00084230 predicted 1949
9 SASI_Mm01_00084231 predicted 1538
10 SASI_Mm01_00084233 predicted 627
11 SASI_Mm01_00084232 predicted 2074
12 SASI_Mm01_00084234 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010118
EGR2 MISSION shRNA Bacterial Glycerol Stock
early growth response 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-1545s21c1
Sequence:CCGGACTATTGTGGCCGCAAGTTTGCTCGAGCAAACTTGCGGCCACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-519s21c1
Sequence:CCGGGAGATGGCATGATCAACATTGCTCGAGCAATGTTGATCATGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-900s21c1
Sequence:GTACCGGAGGATCCTTCAGCATTCTTATCTCGAGATAAGAATGCTGAAGGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-1144s21c1
Sequence:CCGGACTCTCTACCATCCGTAATTTCTCGAGAAATTACGGATGGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010118.3-2699s21c1
Sequence:CCGGCTGTATATTTCTGCCTATTAACTCGAGTTAATAGGCAGAAATATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010118.1-2588s1c1
Sequence:CCGGGCTGTATATTTCTGCCTATTACTCGAGTAATAGGCAGAAATATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-1032s1c1
Sequence:CCGGCCACTCTCTACCATCCGTAATCTCGAGATTACGGATGGTAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-508s1c1
Sequence:CCGGCCTTCACCTACATGGGCAAATCTCGAGATTTGCCCATGTAGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-788s1c1
Sequence:CCGGCCAGGATCCTTCAGCATTCTTCTCGAGAAGAATGCTGAAGGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-567s1c1
Sequence:CCGGCCAGAAGGTATCATCAATATTCTCGAGAATATTGATGATACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010118
EGR2 MISSION shRNA shRNA Plasmid DNA
early growth response 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-1545s21c1
Sequence:CCGGACTATTGTGGCCGCAAGTTTGCTCGAGCAAACTTGCGGCCACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-519s21c1
Sequence:CCGGGAGATGGCATGATCAACATTGCTCGAGCAATGTTGATCATGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-900s21c1
Sequence:GTACCGGAGGATCCTTCAGCATTCTTATCTCGAGATAAGAATGCTGAAGGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-1144s21c1
Sequence:CCGGACTCTCTACCATCCGTAATTTCTCGAGAAATTACGGATGGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010118.3-2699s21c1
Sequence:CCGGCTGTATATTTCTGCCTATTAACTCGAGTTAATAGGCAGAAATATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010118.1-2588s1c1
Sequence:CCGGGCTGTATATTTCTGCCTATTACTCGAGTAATAGGCAGAAATATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-1032s1c1
Sequence:CCGGCCACTCTCTACCATCCGTAATCTCGAGATTACGGATGGTAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-508s1c1
Sequence:CCGGCCTTCACCTACATGGGCAAATCTCGAGATTTGCCCATGTAGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-788s1c1
Sequence:CCGGCCAGGATCCTTCAGCATTCTTCTCGAGAAGAATGCTGAAGGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-567s1c1
Sequence:CCGGCCAGAAGGTATCATCAATATTCTCGAGAATATTGATGATACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010118
EGR2 MISSION shRNA Lentiviral Transduction Particles
early growth response 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-1545s21c1
Sequence:CCGGACTATTGTGGCCGCAAGTTTGCTCGAGCAAACTTGCGGCCACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-519s21c1
Sequence:CCGGGAGATGGCATGATCAACATTGCTCGAGCAATGTTGATCATGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-900s21c1
Sequence:GTACCGGAGGATCCTTCAGCATTCTTATCTCGAGATAAGAATGCTGAAGGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010118.3-1144s21c1
Sequence:CCGGACTCTCTACCATCCGTAATTTCTCGAGAAATTACGGATGGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010118.3-2699s21c1
Sequence:CCGGCTGTATATTTCTGCCTATTAACTCGAGTTAATAGGCAGAAATATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010118.1-2588s1c1
Sequence:CCGGGCTGTATATTTCTGCCTATTACTCGAGTAATAGGCAGAAATATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-1032s1c1
Sequence:CCGGCCACTCTCTACCATCCGTAATCTCGAGATTACGGATGGTAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-508s1c1
Sequence:CCGGCCTTCACCTACATGGGCAAATCTCGAGATTTGCCCATGTAGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-788s1c1
Sequence:CCGGCCAGGATCCTTCAGCATTCTTCTCGAGAAGAATGCTGAAGGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010118.1-567s1c1
Sequence:CCGGCCAGAAGGTATCATCAATATTCTCGAGAATATTGATGATACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000399
EGR2 MISSION shRNA Bacterial Glycerol Stock
early growth response 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000399.2-2402s1c1
Sequence:CCGGCGTAGCAATATCTGCTCCTTTCTCGAGAAAGGAGCAGATATTGCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-368s1c1
Sequence:CCGGCCCAGTAACTCTCAGTGGTTTCTCGAGAAACCACTGAGAGTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-1007s1c1
Sequence:CCGGCCCAGACTATCCTGGATTCTTCTCGAGAAGAATCCAGGATAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-1131s1c1
Sequence:CCGGCTCTCTACAATCCGTAACTTTCTCGAGAAAGTTACGGATTGTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-605s1c1
Sequence:CCGGCTTCACTTACATGGGCAAGTTCTCGAGAACTTGCCCATGTAAGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000399
EGR2 MISSION shRNA shRNA Plasmid DNA
early growth response 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000399.2-2402s1c1
Sequence:CCGGCGTAGCAATATCTGCTCCTTTCTCGAGAAAGGAGCAGATATTGCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-368s1c1
Sequence:CCGGCCCAGTAACTCTCAGTGGTTTCTCGAGAAACCACTGAGAGTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-1007s1c1
Sequence:CCGGCCCAGACTATCCTGGATTCTTCTCGAGAAGAATCCAGGATAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-1131s1c1
Sequence:CCGGCTCTCTACAATCCGTAACTTTCTCGAGAAAGTTACGGATTGTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-605s1c1
Sequence:CCGGCTTCACTTACATGGGCAAGTTCTCGAGAACTTGCCCATGTAAGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000399
EGR2 MISSION shRNA Lentiviral Transduction Particles
early growth response 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000399.2-2402s1c1
Sequence:CCGGCGTAGCAATATCTGCTCCTTTCTCGAGAAAGGAGCAGATATTGCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-368s1c1
Sequence:CCGGCCCAGTAACTCTCAGTGGTTTCTCGAGAAACCACTGAGAGTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-1007s1c1
Sequence:CCGGCCCAGACTATCCTGGATTCTTCTCGAGAAGAATCCAGGATAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-1131s1c1
Sequence:CCGGCTCTCTACAATCCGTAACTTTCTCGAGAAAGTTACGGATTGTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000399.2-605s1c1
Sequence:CCGGCTTCACTTACATGGGCAAGTTCTCGAGAACTTGCCCATGTAAGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks