EMAIL THIS PAGE TO A FRIEND

EGR3

early growth response 3

247 Gene Product Result for
Synonyms: EGR-3 PILOT
UniProtKB ID: Q06889, A8K8U9, B4DHJ5, E7EW38, Q2M3W2
Gene ID:
Human(1960) Summary: This gene encodes a transcriptional regulator that belongs to the EGR family of C2H2-type zinc-finger proteins. It is an immediate-early growth response gene which is induced by mitogenic stimulation. The protein encoded by this gene participates in the transcriptional regulation of genes in controling biological rhythm. It may also play a role in a wide variety of processes including muscle development, lymphocyte development, endothelial cell growth and migration, and neuronal development. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2010]
Mouse(13655) early growth response 3
Rat(25148) early growth response 3
Zebrafish(436920) early growth response 3
cow(526233) early growth response 3
Horse(100057675) early growth response 3
domestic cat(101086390) early growth response 3
dog(486121) early growth response 3
sheep(101121578) early growth response 3
domestic guinea pig(100728858) early growth response 3
naked mole-rat(101726389) early growth response 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004430 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038101 MISSION® esiRNA esiRNA targeting mouse Egr3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004430 Rosetta Predictions human pricing
NM_017086 Rosetta Predictions rat pricing
NM_018781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015465 predicted 1768
2 SASI_Hs01_00015466 predicted 843
3 SASI_Hs02_00337598 predicted 1278
4 SASI_Hs01_00015467 predicted 799
5 SASI_Hs01_00015468 predicted 1774
6 SASI_Hs01_00015469 predicted 1043
7 SASI_Hs01_00015470 predicted 1313
8 SASI_Hs01_00015472 predicted 1356
9 SASI_Hs01_00015473 predicted 640
10 SASI_Hs02_00337599 predicted 1199
11 SASI_Hs01_00015471 predicted 908
12 SASI_Hs01_00015474 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261299 predicted 746
2 SASI_Rn01_00108135 predicted 192
3 SASI_Rn01_00108136 predicted 434
4 SASI_Rn01_00108137 predicted 265
5 SASI_Rn01_00108138 predicted 242
6 SASI_Rn01_00108139 predicted 744
7 SASI_Rn01_00108140 predicted 280
8 SASI_Rn02_00261300 predicted 267
9 SASI_Rn01_00108141 predicted 683
10 SASI_Rn01_00108142 predicted 598
11 SASI_Rn01_00108134 predicted 694
12 SASI_Rn01_00108143 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023357 predicted 488
2 SASI_Mm01_00023358 predicted 1048
3 SASI_Mm01_00023359 predicted 917
4 SASI_Mm01_00023360 predicted 439
5 SASI_Mm01_00023363 predicted 843
6 SASI_Mm01_00023364 predicted 686
7 SASI_Mm01_00023365 predicted 280
8 SASI_Mm01_00023366 predicted 1006
9 SASI_Mm02_00324090 predicted 1048
10 SASI_Mm02_00324091 predicted 597
11 SASI_Mm01_00023361 predicted 264
12 SASI_Mm01_00023362 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004430
VALIDATED
EGR3 MISSION shRNA Bacterial Glycerol Stock
early growth response 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004430.2-3182s1c1
Sequence:CCGGGCTCCTTTGAAGTGGAGTAATCTCGAGATTACTCCACTTCAAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-478s1c1
Sequence:CCGGCGACTCGGTAGTCCATTACAACTCGAGTTGTAATGGACTACCGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004430.2-407s1c1
Sequence:CCGGCTAAACCAACTGCCTGACAATCTCGAGATTGTCAGGCAGTTGGTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-956s1c1
Sequence:CCGGCCCAACGACATGGGCTCCATTCTCGAGAATGGAGCCCATGTCGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-604s1c1
Sequence:CCGGCGTGACCTACTTGGGAAAGTTCTCGAGAACTTTCCCAAGTAGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-604s21c1
Sequence:CCGGCGTGACCTACTTGGGAAAGTTCTCGAGAACTTTCCCAAGTAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-901s21c1
Sequence:CCGGGGCGTTGGACAGCAATCTCTTCTCGAGAAGAGATTGCTGTCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-502s21c1
Sequence:CCGGGATGGCTACAGAGAATGTAATCTCGAGATTACATTCTCTGTAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-648s21c1
Sequence:CCGGGGTGCCAGGACAACATCATTACTCGAGTAATGATGTTGTCCTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-1044s21c1
Sequence:CCGGAGACCATCAAGGCATTCAAAGCTCGAGCTTTGAATGCCTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004430
VALIDATED
EGR3 MISSION shRNA shRNA Plasmid DNA
early growth response 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004430.2-3182s1c1
Sequence:CCGGGCTCCTTTGAAGTGGAGTAATCTCGAGATTACTCCACTTCAAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-478s1c1
Sequence:CCGGCGACTCGGTAGTCCATTACAACTCGAGTTGTAATGGACTACCGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004430.2-407s1c1
Sequence:CCGGCTAAACCAACTGCCTGACAATCTCGAGATTGTCAGGCAGTTGGTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-956s1c1
Sequence:CCGGCCCAACGACATGGGCTCCATTCTCGAGAATGGAGCCCATGTCGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-604s1c1
Sequence:CCGGCGTGACCTACTTGGGAAAGTTCTCGAGAACTTTCCCAAGTAGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-604s21c1
Sequence:CCGGCGTGACCTACTTGGGAAAGTTCTCGAGAACTTTCCCAAGTAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-901s21c1
Sequence:CCGGGGCGTTGGACAGCAATCTCTTCTCGAGAAGAGATTGCTGTCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-502s21c1
Sequence:CCGGGATGGCTACAGAGAATGTAATCTCGAGATTACATTCTCTGTAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-648s21c1
Sequence:CCGGGGTGCCAGGACAACATCATTACTCGAGTAATGATGTTGTCCTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-1044s21c1
Sequence:CCGGAGACCATCAAGGCATTCAAAGCTCGAGCTTTGAATGCCTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004430
VALIDATED
EGR3 MISSION shRNA Lentiviral Transduction Particles
early growth response 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004430.2-3182s1c1
Sequence:CCGGGCTCCTTTGAAGTGGAGTAATCTCGAGATTACTCCACTTCAAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-478s1c1
Sequence:CCGGCGACTCGGTAGTCCATTACAACTCGAGTTGTAATGGACTACCGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004430.2-407s1c1
Sequence:CCGGCTAAACCAACTGCCTGACAATCTCGAGATTGTCAGGCAGTTGGTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-956s1c1
Sequence:CCGGCCCAACGACATGGGCTCCATTCTCGAGAATGGAGCCCATGTCGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004430.2-604s1c1
Sequence:CCGGCGTGACCTACTTGGGAAAGTTCTCGAGAACTTTCCCAAGTAGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-604s21c1
Sequence:CCGGCGTGACCTACTTGGGAAAGTTCTCGAGAACTTTCCCAAGTAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-901s21c1
Sequence:CCGGGGCGTTGGACAGCAATCTCTTCTCGAGAAGAGATTGCTGTCCAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-502s21c1
Sequence:CCGGGATGGCTACAGAGAATGTAATCTCGAGATTACATTCTCTGTAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-648s21c1
Sequence:CCGGGGTGCCAGGACAACATCATTACTCGAGTAATGATGTTGTCCTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004430.2-1044s21c1
Sequence:CCGGAGACCATCAAGGCATTCAAAGCTCGAGCTTTGAATGCCTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018781
EGR3 MISSION shRNA Bacterial Glycerol Stock
early growth response 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-131s1c1
Sequence:CCGGCCCATTACAATCAGATGGCTACTCGAGTAGCCATCTGATTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-191s1c1
Sequence:CCGGCCAATCCGGAACTCTCTTATTCTCGAGAATAAGAGAGTTCCGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-48s1c1
Sequence:CCGGGCTAAATCAATTGCCTGACAACTCGAGTTGTCAGGCAATTGATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-130s1c1
Sequence:CCGGGCCCATTACAATCAGATGGCTCTCGAGAGCCATCTGATTGTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018781.1-1170s1c1
Sequence:CCGGCGGCACCCAGATCCCTTCTTTCTCGAGAAAGAAGGGATCTGGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018781.2-168s21c1
Sequence:CCGGCATCGGTCTGACCAACGAGAACTCGAGTTCTCGTTGGTCAGACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018781
EGR3 MISSION shRNA shRNA Plasmid DNA
early growth response 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-131s1c1
Sequence:CCGGCCCATTACAATCAGATGGCTACTCGAGTAGCCATCTGATTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-191s1c1
Sequence:CCGGCCAATCCGGAACTCTCTTATTCTCGAGAATAAGAGAGTTCCGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-48s1c1
Sequence:CCGGGCTAAATCAATTGCCTGACAACTCGAGTTGTCAGGCAATTGATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-130s1c1
Sequence:CCGGGCCCATTACAATCAGATGGCTCTCGAGAGCCATCTGATTGTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018781.1-1170s1c1
Sequence:CCGGCGGCACCCAGATCCCTTCTTTCTCGAGAAAGAAGGGATCTGGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018781.2-168s21c1
Sequence:CCGGCATCGGTCTGACCAACGAGAACTCGAGTTCTCGTTGGTCAGACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018781
EGR3 MISSION shRNA Lentiviral Transduction Particles
early growth response 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-131s1c1
Sequence:CCGGCCCATTACAATCAGATGGCTACTCGAGTAGCCATCTGATTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-191s1c1
Sequence:CCGGCCAATCCGGAACTCTCTTATTCTCGAGAATAAGAGAGTTCCGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-48s1c1
Sequence:CCGGGCTAAATCAATTGCCTGACAACTCGAGTTGTCAGGCAATTGATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018781.1-130s1c1
Sequence:CCGGGCCCATTACAATCAGATGGCTCTCGAGAGCCATCTGATTGTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018781.1-1170s1c1
Sequence:CCGGCGGCACCCAGATCCCTTCTTTCTCGAGAAAGAAGGGATCTGGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018781.2-168s21c1
Sequence:CCGGCATCGGTCTGACCAACGAGAACTCGAGTTCTCGTTGGTCAGACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks