EMAIL THIS PAGE TO A FRIEND

EGR4

early growth response 4

67 Gene Product Result for
Synonyms: NGFI-C NGFIC PAT133
UniProtKB ID: Q05215, B2RAE3, G3V1T5, Q2Z1P5
Gene ID:
Mouse(13656) early growth response 4
Rat(25129) early growth response 4
naked mole-rat(101705160) early growth response 4
domestic guinea pig(100716993) early growth response 4
sheep(101113051) early growth response 4
chicken(422950) early growth response 4
cow(407155) early growth response 4
domestic cat(101081722) early growth response 4
dog(483112) early growth response 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001965 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135811 MISSION® esiRNA esiRNA human EGR4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001965 Rosetta Predictions human pricing
NM_019137 Rosetta Predictions rat pricing
NM_020596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066557 predicted 1683
2 SASI_Hs01_00066558 predicted 1465
3 SASI_Hs01_00066559 predicted 1589
4 SASI_Hs02_00332920 predicted 918
5 SASI_Hs01_00066560 predicted 1594
6 SASI_Hs01_00066561 predicted 933
7 SASI_Hs01_00066563 predicted 1199
8 SASI_Hs02_00332921 predicted 923
9 SASI_Hs02_00332922 predicted 532
10 SASI_Hs01_00066565 predicted 1379
11 SASI_Hs01_00066562 predicted 894
12 SASI_Hs01_00066564 predicted 1608
13 SASI_Hs01_00066566 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082936 predicted 1884
2 SASI_Rn01_00082937 predicted 1531
3 SASI_Rn01_00082938 predicted 1404
4 SASI_Rn02_00261887 predicted 1870
5 SASI_Rn01_00082941 predicted 1574
6 SASI_Rn01_00082942 predicted 966
7 SASI_Rn01_00082943 predicted 1518
8 SASI_Rn01_00082944 predicted 1536
9 SASI_Rn02_00261888 predicted 1582
10 SASI_Rn02_00261889 predicted 841
11 SASI_Rn01_00082939 predicted 589
12 SASI_Rn01_00082940 predicted 450
13 SASI_Rn01_00082945 predicted 1890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110072 predicted 1488
2 SASI_Mm01_00110074 predicted 1355
3 SASI_Mm01_00110075 predicted 579
4 SASI_Mm01_00110076 predicted 1483
5 SASI_Mm01_00110077 predicted 923
6 SASI_Mm01_00110078 predicted 543
7 SASI_Mm02_00325693 predicted 1766
8 SASI_Mm01_00110079 predicted 1541
9 SASI_Mm02_00325694 predicted 273
10 SASI_Mm01_00110081 predicted 1469
11 SASI_Mm01_00110073 predicted 1838
12 SASI_Mm01_00110080 predicted 1776
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020596
EGR4 MISSION shRNA Bacterial Glycerol Stock
early growth response 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020596.2-1359s21c1
Sequence:CCGGGCATCTGCCTGCGCAACTTCACTCGAGTGAAGTTGCGCAGGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020596.2-830s21c1
Sequence:CCGGTTCTCTGCAGTAGGGACCAAGCTCGAGCTTGGTCCCTACTGCAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020596.2-1892s21c1
Sequence:CCGGACGCCTTCCTCTTTATCCCTCCTCGAGGAGGGATAAAGAGGAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-1486s1c1
Sequence:CCGGGCACAGCAAGGTGCACCTAAACTCGAGTTTAGGTGCACCTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-1463s1c1
Sequence:CCGGGCGCGCAGTGACGAGAAGAAACTCGAGTTTCTTCTCGTCACTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-280s1c1
Sequence:CCGGCGACTTCTTGAGCTGGGCTTTCTCGAGAAAGCCCAGCTCAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-442s1c1
Sequence:CCGGCTTCAACCTCATGTCTGGCATCTCGAGATGCCAGACATGAGGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020596.1-1942s1c1
Sequence:CCGGCGGTCTCTTAAGAACTTTGTACTCGAGTACAAAGTTCTTAAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020596
EGR4 MISSION shRNA shRNA Plasmid DNA
early growth response 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020596.2-1359s21c1
Sequence:CCGGGCATCTGCCTGCGCAACTTCACTCGAGTGAAGTTGCGCAGGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020596.2-830s21c1
Sequence:CCGGTTCTCTGCAGTAGGGACCAAGCTCGAGCTTGGTCCCTACTGCAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020596.2-1892s21c1
Sequence:CCGGACGCCTTCCTCTTTATCCCTCCTCGAGGAGGGATAAAGAGGAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-1486s1c1
Sequence:CCGGGCACAGCAAGGTGCACCTAAACTCGAGTTTAGGTGCACCTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-1463s1c1
Sequence:CCGGGCGCGCAGTGACGAGAAGAAACTCGAGTTTCTTCTCGTCACTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-280s1c1
Sequence:CCGGCGACTTCTTGAGCTGGGCTTTCTCGAGAAAGCCCAGCTCAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-442s1c1
Sequence:CCGGCTTCAACCTCATGTCTGGCATCTCGAGATGCCAGACATGAGGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020596.1-1942s1c1
Sequence:CCGGCGGTCTCTTAAGAACTTTGTACTCGAGTACAAAGTTCTTAAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020596
EGR4 MISSION shRNA Lentiviral Transduction Particles
early growth response 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020596.2-1359s21c1
Sequence:CCGGGCATCTGCCTGCGCAACTTCACTCGAGTGAAGTTGCGCAGGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020596.2-830s21c1
Sequence:CCGGTTCTCTGCAGTAGGGACCAAGCTCGAGCTTGGTCCCTACTGCAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020596.2-1892s21c1
Sequence:CCGGACGCCTTCCTCTTTATCCCTCCTCGAGGAGGGATAAAGAGGAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-1486s1c1
Sequence:CCGGGCACAGCAAGGTGCACCTAAACTCGAGTTTAGGTGCACCTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-1463s1c1
Sequence:CCGGGCGCGCAGTGACGAGAAGAAACTCGAGTTTCTTCTCGTCACTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-280s1c1
Sequence:CCGGCGACTTCTTGAGCTGGGCTTTCTCGAGAAAGCCCAGCTCAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020596.1-442s1c1
Sequence:CCGGCTTCAACCTCATGTCTGGCATCTCGAGATGCCAGACATGAGGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020596.1-1942s1c1
Sequence:CCGGCGGTCTCTTAAGAACTTTGTACTCGAGTACAAAGTTCTTAAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001965
EGR4 MISSION shRNA Bacterial Glycerol Stock
early growth response 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-1538s21c1
Sequence:CCGGAGAGTTGTGTGCGGAGCTTTGCTCGAGCAAAGCTCCGCACACAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-385s21c1
Sequence:CCGGATGCTCCACCTTAGCGAGTTTCTCGAGAAACTCGCTAAGGTGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-692s21c1
Sequence:CCGGACCTCATGTCGGGCATCTTAGCTCGAGCTAAGATGCCCGACATGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-1359s21c1
Sequence:CCGGTAAACCTCTGGTGGCGGACATCTCGAGATGTCCGCCACCAGAGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001965.1-1891s1c1
Sequence:CCGGCCTGGGATTCAAGACAGTCTTCTCGAGAAGACTGTCTTGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-866s1c1
Sequence:CCGGCCCGTAATAGGGACCAAGATTCTCGAGAATCTTGGTCCCTATTACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-403s1c1
Sequence:CCGGCCTCAGCTACAGCGGTAGCTTCTCGAGAAGCTACCGCTGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-203s1c1
Sequence:CCGGCTCCTCGTCAAGTCCACTGAACTCGAGTTCAGTGGACTTGACGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001965
EGR4 MISSION shRNA shRNA Plasmid DNA
early growth response 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-1538s21c1
Sequence:CCGGAGAGTTGTGTGCGGAGCTTTGCTCGAGCAAAGCTCCGCACACAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-385s21c1
Sequence:CCGGATGCTCCACCTTAGCGAGTTTCTCGAGAAACTCGCTAAGGTGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-692s21c1
Sequence:CCGGACCTCATGTCGGGCATCTTAGCTCGAGCTAAGATGCCCGACATGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-1359s21c1
Sequence:CCGGTAAACCTCTGGTGGCGGACATCTCGAGATGTCCGCCACCAGAGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001965.1-1891s1c1
Sequence:CCGGCCTGGGATTCAAGACAGTCTTCTCGAGAAGACTGTCTTGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-866s1c1
Sequence:CCGGCCCGTAATAGGGACCAAGATTCTCGAGAATCTTGGTCCCTATTACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-403s1c1
Sequence:CCGGCCTCAGCTACAGCGGTAGCTTCTCGAGAAGCTACCGCTGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-203s1c1
Sequence:CCGGCTCCTCGTCAAGTCCACTGAACTCGAGTTCAGTGGACTTGACGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001965
EGR4 MISSION shRNA Lentiviral Transduction Particles
early growth response 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-1538s21c1
Sequence:CCGGAGAGTTGTGTGCGGAGCTTTGCTCGAGCAAAGCTCCGCACACAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-385s21c1
Sequence:CCGGATGCTCCACCTTAGCGAGTTTCTCGAGAAACTCGCTAAGGTGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-692s21c1
Sequence:CCGGACCTCATGTCGGGCATCTTAGCTCGAGCTAAGATGCCCGACATGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001965.3-1359s21c1
Sequence:CCGGTAAACCTCTGGTGGCGGACATCTCGAGATGTCCGCCACCAGAGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001965.1-1891s1c1
Sequence:CCGGCCTGGGATTCAAGACAGTCTTCTCGAGAAGACTGTCTTGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-866s1c1
Sequence:CCGGCCCGTAATAGGGACCAAGATTCTCGAGAATCTTGGTCCCTATTACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-403s1c1
Sequence:CCGGCCTCAGCTACAGCGGTAGCTTCTCGAGAAGCTACCGCTGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001965.1-203s1c1
Sequence:CCGGCTCCTCGTCAAGTCCACTGAACTCGAGTTCAGTGGACTTGACGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks