EMAIL THIS PAGE TO A FRIEND

EHBP1

EH domain binding protein 1

127 Gene Product Result for
Synonyms: HPC12 NACSIN
Gene ID:
Human(23301) Summary: This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(216565) EH domain binding protein 1
Rat(305556) EH domain binding protein 1
fruit fly(36912) Eps15 homology domain containing protein-binding protein 1
dog(481386) EH domain binding protein 1
domestic cat(101081286) EH domain binding protein 1
Horse(100051749) EH domain binding protein 1
cow(100300164) EH domain binding protein 1
chicken(421282) EH domain binding protein 1
sheep(101116893) EH domain binding protein 1
Domestic Rabbit(100341927) EH domain binding protein 1
domestic guinea pig(100730621) EH domain binding protein 1
naked mole-rat(101721715) EH domain binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074441 MISSION® esiRNA esiRNA human EHBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015252 Rosetta Predictions human pricing
XM_001056688 Rosetta Predictions rat pricing
XM_001056760 Rosetta Predictions rat pricing
XM_223664 Rosetta Predictions rat pricing
NM_153078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097428 predicted 3720
2 SASI_Hs01_00097429 predicted 3322
3 SASI_Hs02_00347388 predicted 1419
4 SASI_Hs01_00097431 predicted 2185
5 SASI_Hs01_00097432 predicted 743
6 SASI_Hs02_00347389 predicted 1642
7 SASI_Hs01_00097433 predicted 2091
8 SASI_Hs01_00097434 predicted 1432
9 SASI_Hs01_00097435 predicted 2550
10 SASI_Hs01_00097436 predicted 939
11 SASI_Hs01_00097430 predicted 2447
12 SASI_Hs01_00097437 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284072 predicted 614
2 SASI_Rn02_00284073 predicted 954
3 SASI_Rn02_00284074 predicted 920
4 SASI_Rn02_00284075 predicted 1668
5 SASI_Rn02_00284076 predicted 3747
6 SASI_Rn02_00284077 predicted 1957
7 SASI_Rn02_00284078 predicted 3132
8 SASI_Rn02_00284079 predicted 3322
9 SASI_Rn02_00284080 predicted 1480
10 SASI_Rn02_00284081 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284336 predicted 890
2 SASI_Rn02_00284337 predicted 457
3 SASI_Rn02_00284338 predicted 801
4 SASI_Rn02_00284339 predicted 761
5 SASI_Rn02_00284340 predicted 1444
6 SASI_Rn02_00284341 predicted 3517
7 SASI_Rn02_00284342 predicted 1728
8 SASI_Rn02_00284343 predicted 2906
9 SASI_Rn02_00284344 predicted 3089
10 SASI_Rn02_00284345 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381567 predicted 1795
2 SASI_Rn02_00381568 predicted 2148
3 SASI_Rn02_00381569 predicted 2102
4 SASI_Rn02_00381570 predicted 2855
5 SASI_Rn02_00381571 predicted 4941
6 SASI_Rn02_00381572 predicted 3144
7 SASI_Rn02_00381573 predicted 4326
8 SASI_Rn02_00381574 predicted 4509
9 SASI_Rn02_00381575 predicted 2671
10 SASI_Rn02_00381576 predicted 2455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134481 predicted 741
2 SASI_Mm01_00134482 predicted 431
3 SASI_Mm01_00134483 predicted 780
4 SASI_Mm01_00134484 predicted 2638
5 SASI_Mm01_00134485 predicted 748
6 SASI_Mm02_00342906 predicted 1745
7 SASI_Mm01_00134487 predicted 757
8 SASI_Mm01_00134488 predicted 878
9 SASI_Mm01_00134489 predicted 1726
10 SASI_Mm02_00342907 predicted 2302
11 SASI_Mm01_00134486 predicted 2906
12 SASI_Mm01_00134490 predicted 3526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015252
VALIDATED
EHBP1 MISSION shRNA Bacterial Glycerol Stock
EH domain binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-4761s1c1
Sequence:CCGGCCAGTTTACAAAGACAGTCTTCTCGAGAAGACTGTCTTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015252.2-486s1c1
Sequence:CCGGCCAGATAAACTGGTGGTAGTTCTCGAGAACTACCACCAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-3985s1c1
Sequence:CCGGCCGAAGAAGAAGATGAGCATTCTCGAGAATGCTCATCTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-3759s1c1
Sequence:CCGGGCCTTAATAAGGAGAATGAATCTCGAGATTCATTCTCCTTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-4644s21c1
Sequence:CCGGCACTTACTCTGTTACCTAAATCTCGAGATTTAGGTAACAGAGTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-591s21c1
Sequence:CCGGCCAGATAAACTGGTGGTAGTTCTCGAGAACTACCACCAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-2701s21c1
Sequence:CCGGCCAGATCCTTAGAATGCAGATCTCGAGATCTGCATTCTAAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-4090s21c1
Sequence:CCGGCCGAAGAAGAAGATGAGCATTCTCGAGAATGCTCATCTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-2021s21c1
Sequence:CCGGCATAGGAATTTCCCGATTATTCTCGAGAATAATCGGGAAATTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015252
VALIDATED
EHBP1 MISSION shRNA shRNA Plasmid DNA
EH domain binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-4761s1c1
Sequence:CCGGCCAGTTTACAAAGACAGTCTTCTCGAGAAGACTGTCTTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015252.2-486s1c1
Sequence:CCGGCCAGATAAACTGGTGGTAGTTCTCGAGAACTACCACCAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-3985s1c1
Sequence:CCGGCCGAAGAAGAAGATGAGCATTCTCGAGAATGCTCATCTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-3759s1c1
Sequence:CCGGGCCTTAATAAGGAGAATGAATCTCGAGATTCATTCTCCTTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-4644s21c1
Sequence:CCGGCACTTACTCTGTTACCTAAATCTCGAGATTTAGGTAACAGAGTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-591s21c1
Sequence:CCGGCCAGATAAACTGGTGGTAGTTCTCGAGAACTACCACCAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-2701s21c1
Sequence:CCGGCCAGATCCTTAGAATGCAGATCTCGAGATCTGCATTCTAAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-4090s21c1
Sequence:CCGGCCGAAGAAGAAGATGAGCATTCTCGAGAATGCTCATCTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-2021s21c1
Sequence:CCGGCATAGGAATTTCCCGATTATTCTCGAGAATAATCGGGAAATTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015252
VALIDATED
EHBP1 MISSION shRNA Lentiviral Transduction Particles
EH domain binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-4761s1c1
Sequence:CCGGCCAGTTTACAAAGACAGTCTTCTCGAGAAGACTGTCTTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015252.2-486s1c1
Sequence:CCGGCCAGATAAACTGGTGGTAGTTCTCGAGAACTACCACCAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-3985s1c1
Sequence:CCGGCCGAAGAAGAAGATGAGCATTCTCGAGAATGCTCATCTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015252.2-3759s1c1
Sequence:CCGGGCCTTAATAAGGAGAATGAATCTCGAGATTCATTCTCCTTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-4644s21c1
Sequence:CCGGCACTTACTCTGTTACCTAAATCTCGAGATTTAGGTAACAGAGTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-591s21c1
Sequence:CCGGCCAGATAAACTGGTGGTAGTTCTCGAGAACTACCACCAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-2701s21c1
Sequence:CCGGCCAGATCCTTAGAATGCAGATCTCGAGATCTGCATTCTAAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-4090s21c1
Sequence:CCGGCCGAAGAAGAAGATGAGCATTCTCGAGAATGCTCATCTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015252.3-2021s21c1
Sequence:CCGGCATAGGAATTTCCCGATTATTCTCGAGAATAATCGGGAAATTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153078
VALIDATED
EHBP1 MISSION shRNA Bacterial Glycerol Stock
EH domain binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-741s1c1
Sequence:CCGGCGGATGAAGATATGCAGAGTTCTCGAGAACTCTGCATATCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-2441s1c1
Sequence:CCGGGCTATCACAAAGCCAAATGTACTCGAGTACATTTGGCTTTGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153078.1-1035s1c1
Sequence:CCGGCCACTGTGAATACCAATCCATCTCGAGATGGATTGGTATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153078.1-4565s1c1
Sequence:CCGGGCACCATCTTATACTCTGAATCTCGAGATTCAGAGTATAAGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-1614s1c1
Sequence:CCGGCGTGGAGGAATGGCTTATCATCTCGAGATGATAAGCCATTCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-1614s21c1
Sequence:CCGGCGTGGAGGAATGGCTTATCATCTCGAGATGATAAGCCATTCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-636s21c1
Sequence:CCGGCACAAACTGACGTCAAGTTAACTCGAGTTAACTTGACGTCAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153078.2-4226s21c1
Sequence:CCGGATTGTTGGTAATAGCGAAATGCTCGAGCATTTCGCTATTACCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-3140s21c1
Sequence:CCGGGATCTCCGGACTGAACGATTACTCGAGTAATCGTTCAGTCCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-2468s21c1
Sequence:CCGGCCTTCTAAACTTGGATATAACCTCGAGGTTATATCCAAGTTTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153078
VALIDATED
EHBP1 MISSION shRNA shRNA Plasmid DNA
EH domain binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-741s1c1
Sequence:CCGGCGGATGAAGATATGCAGAGTTCTCGAGAACTCTGCATATCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-2441s1c1
Sequence:CCGGGCTATCACAAAGCCAAATGTACTCGAGTACATTTGGCTTTGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153078.1-1035s1c1
Sequence:CCGGCCACTGTGAATACCAATCCATCTCGAGATGGATTGGTATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153078.1-4565s1c1
Sequence:CCGGGCACCATCTTATACTCTGAATCTCGAGATTCAGAGTATAAGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-1614s1c1
Sequence:CCGGCGTGGAGGAATGGCTTATCATCTCGAGATGATAAGCCATTCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-1614s21c1
Sequence:CCGGCGTGGAGGAATGGCTTATCATCTCGAGATGATAAGCCATTCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-636s21c1
Sequence:CCGGCACAAACTGACGTCAAGTTAACTCGAGTTAACTTGACGTCAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153078.2-4226s21c1
Sequence:CCGGATTGTTGGTAATAGCGAAATGCTCGAGCATTTCGCTATTACCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-3140s21c1
Sequence:CCGGGATCTCCGGACTGAACGATTACTCGAGTAATCGTTCAGTCCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-2468s21c1
Sequence:CCGGCCTTCTAAACTTGGATATAACCTCGAGGTTATATCCAAGTTTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153078
VALIDATED
EHBP1 MISSION shRNA Lentiviral Transduction Particles
EH domain binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-741s1c1
Sequence:CCGGCGGATGAAGATATGCAGAGTTCTCGAGAACTCTGCATATCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-2441s1c1
Sequence:CCGGGCTATCACAAAGCCAAATGTACTCGAGTACATTTGGCTTTGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153078.1-1035s1c1
Sequence:CCGGCCACTGTGAATACCAATCCATCTCGAGATGGATTGGTATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153078.1-4565s1c1
Sequence:CCGGGCACCATCTTATACTCTGAATCTCGAGATTCAGAGTATAAGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153078.1-1614s1c1
Sequence:CCGGCGTGGAGGAATGGCTTATCATCTCGAGATGATAAGCCATTCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-1614s21c1
Sequence:CCGGCGTGGAGGAATGGCTTATCATCTCGAGATGATAAGCCATTCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-636s21c1
Sequence:CCGGCACAAACTGACGTCAAGTTAACTCGAGTTAACTTGACGTCAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153078.2-4226s21c1
Sequence:CCGGATTGTTGGTAATAGCGAAATGCTCGAGCATTTCGCTATTACCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-3140s21c1
Sequence:CCGGGATCTCCGGACTGAACGATTACTCGAGTAATCGTTCAGTCCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153078.2-2468s21c1
Sequence:CCGGCCTTCTAAACTTGGATATAACCTCGAGGTTATATCCAAGTTTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks