EMAIL THIS PAGE TO A FRIEND

EHBP1L1

EH domain binding protein 1-like 1

168 Gene Product Result for
UniProtKB ID: Q8N3D4, Q8TB89, Q9H7M7
Gene ID:
Mouse(114601) EH domain binding protein 1-like 1
Rat(309169) EH domain binding protein 1-like 1
naked mole-rat(101718921) EH domain binding protein 1-like 1
domestic guinea pig(100730173) EH domain binding protein 1-like 1
sheep(101123511) EH domain binding protein 1-like 1
cow(788760) EH domain binding protein 1-like 1
domestic cat(101098163) EH domain binding protein 1-like 1
dog(483734) EH domain binding protein 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA039479 Anti-EHBP1L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001099409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099409 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042931 MISSION® esiRNA esiRNA human EHBP1L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099409 Rosetta Predictions human pricing
XM_170658 Rosetta Predictions human pricing
XM_934325 Rosetta Predictions human pricing
XM_934328 Rosetta Predictions human pricing
XM_934330 Rosetta Predictions human pricing
XM_934333 Rosetta Predictions human pricing
XM_934336 Rosetta Predictions human pricing
XM_934339 Rosetta Predictions human pricing
XM_934343 Rosetta Predictions human pricing
NM_001025117 Rosetta Predictions rat pricing
NM_001129997 Rosetta Predictions rat pricing
NM_001114595 Rosetta Predictions mouse pricing
NM_001114596 Rosetta Predictions mouse pricing
NM_001114597 Rosetta Predictions mouse pricing
NM_053252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320619 predicted 2437
2 SASI_Hs02_00320620 predicted 1049
3 SASI_Hs02_00320621 predicted 775
4 SASI_Hs02_00320622 predicted 1380
5 SASI_Hs02_00320623 predicted 3490
6 SASI_Hs02_00320624 predicted 2482
7 SASI_Hs02_00320625 predicted 4329
8 SASI_Hs02_00320626 predicted 2726
9 SASI_Hs02_00320627 predicted 2866
10 SASI_Hs02_00320628 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_170658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279453 predicted 2436
2 SASI_Hs01_00279454 predicted 1514
3 SASI_Hs01_00279455 predicted 781
4 SASI_Hs01_00279456 predicted 3496
5 SASI_Hs01_00279457 predicted 2485
6 SASI_Hs01_00279458 predicted 4329
7 SASI_Hs01_00279459 predicted 2724
8 SASI_Hs01_00279460 predicted 4614
9 SASI_Hs01_00279461 predicted 2862
10 SASI_Hs01_00279462 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286007 predicted 310
2 SASI_Hs01_00286008 predicted 349
3 SASI_Hs01_00286009 predicted 356
4 SASI_Hs01_00286010 predicted 325
5 SASI_Hs01_00286011 predicted 274
6 SASI_Hs01_00286012 predicted 311
7 SASI_Hs01_00286013 predicted 317
8 SASI_Hs01_00286014 predicted 313
9 SASI_Hs01_00286015 predicted 382
10 SASI_Hs01_00286016 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271785 predicted 1427
2 SASI_Hs01_00271786 predicted 1472
3 SASI_Hs01_00271787 predicted 1417
4 SASI_Hs01_00271788 predicted 1449
5 SASI_Hs01_00271789 predicted 1465
6 SASI_Hs01_00271790 predicted 1403
7 SASI_Hs01_00271791 predicted 1409
8 SASI_Hs01_00271792 predicted 1465
9 SASI_Hs01_00271793 predicted 1462
10 SASI_Hs01_00271794 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262039 predicted 171
2 SASI_Hs01_00262040 predicted 172
3 SASI_Hs01_00262041 predicted 175
4 SASI_Hs01_00262042 predicted 168
5 SASI_Hs01_00262043 predicted 77
6 SASI_Hs01_00262044 predicted 32
7 SASI_Hs01_00262045 predicted 177
8 SASI_Hs01_00262046 predicted 180
9 SASI_Hs01_00262047 predicted 180
10 SASI_Hs01_00262048 predicted 165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294359 predicted 905
2 SASI_Hs01_00294360 predicted 908
3 SASI_Hs01_00294361 predicted 841
4 SASI_Hs01_00294362 predicted 904
5 SASI_Hs01_00294363 predicted 900
6 SASI_Hs01_00294364 predicted 901
7 SASI_Hs01_00294365 predicted 991
8 SASI_Hs01_00294366 predicted 871
9 SASI_Hs01_00294367 predicted 869
10 SASI_Hs01_00294368 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279067 predicted 1159
2 SASI_Hs01_00279068 predicted 445
3 SASI_Hs01_00279069 predicted 313
4 SASI_Hs01_00279070 predicted 1150
5 SASI_Hs01_00279071 predicted 1520
6 SASI_Hs01_00279072 predicted 619
7 SASI_Hs01_00279073 predicted 1170
8 SASI_Hs01_00279074 predicted 792
9 SASI_Hs01_00279075 predicted 1302
10 SASI_Hs01_00279076 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250776 predicted 1459
2 SASI_Hs01_00250777 predicted 439
3 SASI_Hs01_00250778 predicted 316
4 SASI_Hs01_00250779 predicted 1445
5 SASI_Hs01_00250780 predicted 1813
6 SASI_Hs01_00250781 predicted 626
7 SASI_Hs01_00250782 predicted 1460
8 SASI_Hs01_00250783 predicted 801
9 SASI_Hs01_00250784 predicted 1597
10 SASI_Hs01_00250785 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258374 predicted 2056
2 SASI_Hs01_00258375 predicted 2043
3 SASI_Hs01_00258376 predicted 2419
4 SASI_Hs01_00258377 predicted 2069
5 SASI_Hs01_00258378 predicted 1219
6 SASI_Hs01_00258379 predicted 2060
7 SASI_Hs01_00258380 predicted 1392
8 SASI_Hs01_00258381 predicted 2199
9 SASI_Hs01_00258382 predicted 2341
10 SASI_Hs01_00258383 predicted 2425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203005 predicted 2441
2 SASI_Rn02_00203006 predicted 1350
3 SASI_Rn02_00203007 predicted 1656
4 SASI_Rn02_00203008 predicted 2421
5 SASI_Rn02_00203009 predicted 1889
6 SASI_Rn02_00203010 predicted 2514
7 SASI_Rn02_00203011 predicted 2082
8 SASI_Rn02_00203012 predicted 437
9 SASI_Rn02_00203013 predicted 1302
10 SASI_Rn02_00203014 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255259 predicted 5212
2 SASI_Rn02_00255260 predicted 4124
3 SASI_Rn02_00255261 predicted 4433
4 SASI_Rn02_00255262 predicted 5193
5 SASI_Rn02_00255263 predicted 4663
6 SASI_Rn02_00255264 predicted 5283
7 SASI_Rn02_00255265 predicted 4855
8 SASI_Rn02_00255266 predicted 435
9 SASI_Rn02_00255267 predicted 4070
10 SASI_Rn02_00255268 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308677 predicted 2357
2 SASI_Mm02_00308678 predicted 551
3 SASI_Mm02_00308679 predicted 2091
4 SASI_Mm02_00308680 predicted 350
5 SASI_Mm02_00308681 predicted 1300
6 SASI_Mm02_00308682 predicted 388
7 SASI_Mm02_00308683 predicted 526
8 SASI_Mm02_00308684 predicted 539
9 SASI_Mm02_00308685 predicted 1509
10 SASI_Mm02_00308686 predicted 2319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308687 predicted 2392
2 SASI_Mm02_00308688 predicted 553
3 SASI_Mm02_00308689 predicted 2122
4 SASI_Mm02_00308690 predicted 346
5 SASI_Mm02_00308691 predicted 1337
6 SASI_Mm02_00308692 predicted 386
7 SASI_Mm02_00308693 predicted 528
8 SASI_Mm02_00308694 predicted 536
9 SASI_Mm02_00308695 predicted 1549
10 SASI_Mm02_00308696 predicted 2355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308697 predicted 5231
2 SASI_Mm02_00308698 predicted 550
3 SASI_Mm02_00308699 predicted 4953
4 SASI_Mm02_00308700 predicted 348
5 SASI_Mm02_00308701 predicted 4167
6 SASI_Mm02_00308702 predicted 390
7 SASI_Mm02_00308703 predicted 529
8 SASI_Mm02_00308704 predicted 543
9 SASI_Mm02_00308705 predicted 4382
10 SASI_Mm02_00308706 predicted 5185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337863 predicted 2702
2 SASI_Mm01_00140931 predicted 558
3 SASI_Mm01_00140932 predicted 2430
4 SASI_Mm02_00337864 predicted 348
5 SASI_Mm01_00140935 predicted 1642
6 SASI_Mm02_00337865 predicted 382
7 SASI_Mm02_00337866 predicted 525
8 SASI_Mm02_00337867 predicted 545
9 SASI_Mm02_00337868 predicted 1855
10 SASI_Mm02_00337869 predicted 2660
11 SASI_Mm01_00140928 predicted 2461
12 SASI_Mm01_00140929 predicted 772
13 SASI_Mm01_00140930 predicted 1753
14 SASI_Mm01_00140933 predicted 3428
15 SASI_Mm01_00140934 predicted 3659
16 SASI_Mm01_00140936 predicted 693
17 SASI_Mm01_00140937 predicted 3202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053252
EHBP1L1 MISSION shRNA Bacterial Glycerol Stock
EH domain binding protein 1-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053252.3-3250s21c1
Sequence:CCGGGAGGGTGGGACTTAGCTAATACTCGAGTATTAGCTAAGTCCCACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-2192s21c1
Sequence:CCGGAGAAGAGGCGATCGAGGTTAACTCGAGTTAACCTCGATCGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-1085s21c1
Sequence:CCGGGGTCAGAACCAGCTGCTATAACTCGAGTTATAGCAGCTGGTTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-349s21c1
Sequence:CCGGTTCCAGTTTGTGGCGTGTTACCTCGAGGTAACACGCCACAAACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-1532s21c1
Sequence:CCGGACCCAGACAAGATCGATTATTCTCGAGAATAATCGATCTTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-1277s1c1
Sequence:CCGGGCTCAGATAAGCTCTCAGGAACTCGAGTTCCTGAGAGCTTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053252.1-5549s1c1
Sequence:CCGGGTGTTTATTTATCCGAGTGTACTCGAGTACACTCGGATAAATAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-2243s1c1
Sequence:CCGGGCAGAAACTGAGATATTAGAACTCGAGTTCTAATATCTCAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-2239s1c1
Sequence:CCGGGATAGCAGAAACTGAGATATTCTCGAGAATATCTCAGTTTCTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-4012s1c1
Sequence:CCGGCCCAGACAAGATCGATTATTTCTCGAGAAATAATCGATCTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053252
EHBP1L1 MISSION shRNA shRNA Plasmid DNA
EH domain binding protein 1-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053252.3-3250s21c1
Sequence:CCGGGAGGGTGGGACTTAGCTAATACTCGAGTATTAGCTAAGTCCCACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-2192s21c1
Sequence:CCGGAGAAGAGGCGATCGAGGTTAACTCGAGTTAACCTCGATCGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-1085s21c1
Sequence:CCGGGGTCAGAACCAGCTGCTATAACTCGAGTTATAGCAGCTGGTTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-349s21c1
Sequence:CCGGTTCCAGTTTGTGGCGTGTTACCTCGAGGTAACACGCCACAAACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-1532s21c1
Sequence:CCGGACCCAGACAAGATCGATTATTCTCGAGAATAATCGATCTTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-1277s1c1
Sequence:CCGGGCTCAGATAAGCTCTCAGGAACTCGAGTTCCTGAGAGCTTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053252.1-5549s1c1
Sequence:CCGGGTGTTTATTTATCCGAGTGTACTCGAGTACACTCGGATAAATAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-2243s1c1
Sequence:CCGGGCAGAAACTGAGATATTAGAACTCGAGTTCTAATATCTCAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-2239s1c1
Sequence:CCGGGATAGCAGAAACTGAGATATTCTCGAGAATATCTCAGTTTCTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-4012s1c1
Sequence:CCGGCCCAGACAAGATCGATTATTTCTCGAGAAATAATCGATCTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053252
EHBP1L1 MISSION shRNA Lentiviral Transduction Particles
EH domain binding protein 1-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053252.3-3250s21c1
Sequence:CCGGGAGGGTGGGACTTAGCTAATACTCGAGTATTAGCTAAGTCCCACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-2192s21c1
Sequence:CCGGAGAAGAGGCGATCGAGGTTAACTCGAGTTAACCTCGATCGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-1085s21c1
Sequence:CCGGGGTCAGAACCAGCTGCTATAACTCGAGTTATAGCAGCTGGTTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-349s21c1
Sequence:CCGGTTCCAGTTTGTGGCGTGTTACCTCGAGGTAACACGCCACAAACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053252.3-1532s21c1
Sequence:CCGGACCCAGACAAGATCGATTATTCTCGAGAATAATCGATCTTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-1277s1c1
Sequence:CCGGGCTCAGATAAGCTCTCAGGAACTCGAGTTCCTGAGAGCTTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053252.1-5549s1c1
Sequence:CCGGGTGTTTATTTATCCGAGTGTACTCGAGTACACTCGGATAAATAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-2243s1c1
Sequence:CCGGGCAGAAACTGAGATATTAGAACTCGAGTTCTAATATCTCAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-2239s1c1
Sequence:CCGGGATAGCAGAAACTGAGATATTCTCGAGAATATCTCAGTTTCTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053252.1-4012s1c1
Sequence:CCGGCCCAGACAAGATCGATTATTTCTCGAGAAATAATCGATCTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099409
VALIDATED
EHBP1L1 MISSION shRNA Bacterial Glycerol Stock
EH domain binding protein 1-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099409.1-5019s21c1
Sequence:CCGGATTTATTTGTCACCGAGGGTGCTCGAGCACCCTCGGTGACAAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099409.1-2060s21c1
Sequence:CCGGACACTAGAAATTGAGATATTGCTCGAGCAATATCTCAATTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-547s21c1
Sequence:CCGGGGCCAAAGAGTGGACATTTATCTCGAGATAAATGTCCACTCTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-1340s21c1
Sequence:CCGGGGCCCGAGCATTGAGGATAAACTCGAGTTTATCCTCAATGCTCGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-2566s21c1
Sequence:CCGGGGCAGCAGAAGGTGCGATATTCTCGAGAATATCGCACCTTCTGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099409
VALIDATED
EHBP1L1 MISSION shRNA shRNA Plasmid DNA
EH domain binding protein 1-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099409.1-5019s21c1
Sequence:CCGGATTTATTTGTCACCGAGGGTGCTCGAGCACCCTCGGTGACAAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099409.1-2060s21c1
Sequence:CCGGACACTAGAAATTGAGATATTGCTCGAGCAATATCTCAATTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-547s21c1
Sequence:CCGGGGCCAAAGAGTGGACATTTATCTCGAGATAAATGTCCACTCTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-1340s21c1
Sequence:CCGGGGCCCGAGCATTGAGGATAAACTCGAGTTTATCCTCAATGCTCGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-2566s21c1
Sequence:CCGGGGCAGCAGAAGGTGCGATATTCTCGAGAATATCGCACCTTCTGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099409
VALIDATED
EHBP1L1 MISSION shRNA Lentiviral Transduction Particles
EH domain binding protein 1-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099409.1-5019s21c1
Sequence:CCGGATTTATTTGTCACCGAGGGTGCTCGAGCACCCTCGGTGACAAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099409.1-2060s21c1
Sequence:CCGGACACTAGAAATTGAGATATTGCTCGAGCAATATCTCAATTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-547s21c1
Sequence:CCGGGGCCAAAGAGTGGACATTTATCTCGAGATAAATGTCCACTCTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-1340s21c1
Sequence:CCGGGGCCCGAGCATTGAGGATAAACTCGAGTTTATCCTCAATGCTCGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099409.1-2566s21c1
Sequence:CCGGGGCAGCAGAAGGTGCGATATTCTCGAGAATATCGCACCTTCTGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks