EMAIL THIS PAGE TO A FRIEND

EHD1

EH-domain containing 1

67 Gene Product Result for
Synonyms: H-PAST HPAST1 PAST PAST1
UniProtKB ID: Q9H4M9, O14611, Q2M3Q4, Q9UNR3
Gene ID:
Human(10938) Summary: This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. [provided by RefSeq, Jul 2008]
Mouse(13660) EH-domain containing 1
Rat(293692) EH-domain containing 1
Thale Cress(821573) EPS15 homology domain 1 protein
domestic cat(101080483) EH-domain containing 1
cow(511908) EH-domain containing 1
dog(100685675) EH-domain containing 1
sheep(101118911) EH-domain containing 1
Domestic Rabbit(100328703) EH-domain containing 1
domestic guinea pig(100723255) EH-domain containing 1
naked mole-rat(101708441) EH-domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006795 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006795 Rosetta Predictions human pricing
XM_001074569 Rosetta Predictions rat pricing
XM_001075679 Rosetta Predictions rat pricing
NM_010119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071013 predicted 1829
2 SASI_Hs01_00071014 predicted 2043
3 SASI_Hs01_00071015 predicted 1207
4 SASI_Hs01_00071016 predicted 2058
5 SASI_Hs01_00071017 predicted 838
6 SASI_Hs01_00071018 predicted 2158
7 SASI_Hs01_00071019 predicted 1584
8 SASI_Hs01_00071020 predicted 2040
9 SASI_Hs01_00071021 predicted 2276
10 SASI_Hs01_00071022 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346688 predicted 1995
2 SASI_Rn02_00346689 predicted 1614
3 SASI_Rn02_00346690 predicted 1266
4 SASI_Rn02_00346691 predicted 949
5 SASI_Rn02_00346692 predicted 2038
6 SASI_Rn02_00346693 predicted 1792
7 SASI_Rn02_00346694 predicted 1545
8 SASI_Rn02_00346695 predicted 1044
9 SASI_Rn02_00346696 predicted 1435
10 SASI_Rn02_00346697 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350685 predicted 1616
2 SASI_Rn02_00350686 predicted 947
3 SASI_Rn02_00350687 predicted 2044
4 SASI_Rn02_00350688 predicted 1796
5 SASI_Rn02_00350689 predicted 1539
6 SASI_Rn02_00350690 predicted 1044
7 SASI_Rn02_00350691 predicted 1428
8 SASI_Rn02_00350692 predicted 822
9 SASI_Rn02_00350693 predicted 1247
10 SASI_Rn02_00350694 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182791 predicted 1465
2 SASI_Mm01_00182792 predicted 825
3 SASI_Mm01_00182793 predicted 1220
4 SASI_Mm01_00182794 predicted 1587
5 SASI_Mm01_00182795 predicted 735
6 SASI_Mm01_00182796 predicted 1109
7 SASI_Mm01_00182798 predicted 623
8 SASI_Mm01_00182799 predicted 1546
9 SASI_Mm01_00182797 predicted 1674
10 SASI_Mm01_00182800 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010119
EHD1 MISSION shRNA Bacterial Glycerol Stock
EH-domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1243s1c1
Sequence:CCGGCAACGATATAGCTCGGCTGATCTCGAGATCAGCCGAGCTATATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1135s1c1
Sequence:CCGGCGACTTCCCAAGCCTGCGTAACTCGAGTTACGCAGGCTTGGGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-532s1c1
Sequence:CCGGCATCATTGACACTCCTGGGATCTCGAGATCCCAGGAGTGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010119.3-1843s1c1
Sequence:CCGGCCTCAGCTCTTGAATAGGAAACTCGAGTTTCCTATTCAAGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1048s1c1
Sequence:CCGGCGGGAAAGAGAGCAAGAAGAACTCGAGTTCTTCTTGCTCTCTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010119
EHD1 MISSION shRNA shRNA Plasmid DNA
EH-domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1243s1c1
Sequence:CCGGCAACGATATAGCTCGGCTGATCTCGAGATCAGCCGAGCTATATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1135s1c1
Sequence:CCGGCGACTTCCCAAGCCTGCGTAACTCGAGTTACGCAGGCTTGGGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-532s1c1
Sequence:CCGGCATCATTGACACTCCTGGGATCTCGAGATCCCAGGAGTGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010119.3-1843s1c1
Sequence:CCGGCCTCAGCTCTTGAATAGGAAACTCGAGTTTCCTATTCAAGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1048s1c1
Sequence:CCGGCGGGAAAGAGAGCAAGAAGAACTCGAGTTCTTCTTGCTCTCTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010119
EHD1 MISSION shRNA Lentiviral Transduction Particles
EH-domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1243s1c1
Sequence:CCGGCAACGATATAGCTCGGCTGATCTCGAGATCAGCCGAGCTATATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1135s1c1
Sequence:CCGGCGACTTCCCAAGCCTGCGTAACTCGAGTTACGCAGGCTTGGGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-532s1c1
Sequence:CCGGCATCATTGACACTCCTGGGATCTCGAGATCCCAGGAGTGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010119.3-1843s1c1
Sequence:CCGGCCTCAGCTCTTGAATAGGAAACTCGAGTTTCCTATTCAAGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010119.3-1048s1c1
Sequence:CCGGCGGGAAAGAGAGCAAGAAGAACTCGAGTTCTTCTTGCTCTCTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006795
VALIDATED
EHD1 MISSION shRNA Bacterial Glycerol Stock
EH-domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006795.2-645s1c1
Sequence:CCGGCGCTTTCCTCAACAGGTTCATCTCGAGATGAACCTGTTGAGGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006795.2-1216s1c1
Sequence:CCGGGTCTTTGGTAAAGAGAGCAAACTCGAGTTTGCTCTCTTTACCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006795.2-1834s1c1
Sequence:CCGGCCGCCCTCCAAGCGCAGACATCTCGAGATGTCTGCGCTTGGAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006795.2-1194s1c1
Sequence:CCGGCCTCAAGAAAGAGATGCCCAACTCGAGTTGGGCATCTCTTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006795.2-645s21c1
Sequence:CCGGCGCTTTCCTCAACAGGTTCATCTCGAGATGAACCTGTTGAGGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-619s21c1
Sequence:CCGGTTCCGCAAGCTCAACGCGTTTCTCGAGAAACGCGTTGAGCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-2092s21c1
Sequence:CCGGCGTTAGAGGCTGCGTTCTTTGCTCGAGCAAAGAACGCAGCCTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-749s21c1
Sequence:CCGGTCAGCAGAGGCTATGACTTTGCTCGAGCAAAGTCATAGCCTCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006795
VALIDATED
EHD1 MISSION shRNA shRNA Plasmid DNA
EH-domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006795.2-645s1c1
Sequence:CCGGCGCTTTCCTCAACAGGTTCATCTCGAGATGAACCTGTTGAGGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006795.2-1216s1c1
Sequence:CCGGGTCTTTGGTAAAGAGAGCAAACTCGAGTTTGCTCTCTTTACCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006795.2-1834s1c1
Sequence:CCGGCCGCCCTCCAAGCGCAGACATCTCGAGATGTCTGCGCTTGGAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006795.2-1194s1c1
Sequence:CCGGCCTCAAGAAAGAGATGCCCAACTCGAGTTGGGCATCTCTTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006795.2-645s21c1
Sequence:CCGGCGCTTTCCTCAACAGGTTCATCTCGAGATGAACCTGTTGAGGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-619s21c1
Sequence:CCGGTTCCGCAAGCTCAACGCGTTTCTCGAGAAACGCGTTGAGCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-2092s21c1
Sequence:CCGGCGTTAGAGGCTGCGTTCTTTGCTCGAGCAAAGAACGCAGCCTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-749s21c1
Sequence:CCGGTCAGCAGAGGCTATGACTTTGCTCGAGCAAAGTCATAGCCTCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006795
VALIDATED
EHD1 MISSION shRNA Lentiviral Transduction Particles
EH-domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006795.2-645s1c1
Sequence:CCGGCGCTTTCCTCAACAGGTTCATCTCGAGATGAACCTGTTGAGGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006795.2-1216s1c1
Sequence:CCGGGTCTTTGGTAAAGAGAGCAAACTCGAGTTTGCTCTCTTTACCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006795.2-1834s1c1
Sequence:CCGGCCGCCCTCCAAGCGCAGACATCTCGAGATGTCTGCGCTTGGAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006795.2-1194s1c1
Sequence:CCGGCCTCAAGAAAGAGATGCCCAACTCGAGTTGGGCATCTCTTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006795.2-645s21c1
Sequence:CCGGCGCTTTCCTCAACAGGTTCATCTCGAGATGAACCTGTTGAGGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-619s21c1
Sequence:CCGGTTCCGCAAGCTCAACGCGTTTCTCGAGAAACGCGTTGAGCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-2092s21c1
Sequence:CCGGCGTTAGAGGCTGCGTTCTTTGCTCGAGCAAAGAACGCAGCCTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006795.2-749s21c1
Sequence:CCGGTCAGCAGAGGCTATGACTTTGCTCGAGCAAAGTCATAGCCTCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks