EMAIL THIS PAGE TO A FRIEND

EHD2

EH-domain containing 2

74 Gene Product Result for
Synonyms: PAST2
UniProtKB ID: Q9NZN4, B2RDH9, Q96CB6
Gene ID:
Human(30846) Summary: This gene encodes a member of the EH domain-containing protein family. These proteins are characterized by a C-terminal EF-hand domain, a nucleotide-binding consensus site at the N terminus and a bipartite nuclear localization signal. The encoded protein interacts with the actin cytoskeleton through an N-terminal domain and also binds to an EH domain-binding protein through the C-terminal EH domain. This interaction appears to connect clathrin-dependent endocytosis to actin, suggesting that this gene product participates in the endocytic pathway. [provided by RefSeq, Jul 2008]
Mouse(259300) EH-domain containing 2
Rat(361512) EH-domain containing 2
Zebrafish(337401) EH-domain containing 2
Thale Cress(825902) EPS15 homology domain 2 protein
domestic cat(101088039) EH-domain containing 2
cow(538348) EH-domain containing 2
dog(484417) EH-domain containing 2
naked mole-rat(101707337) EH-domain containing 2
domestic guinea pig(100719944) EH-domain containing 2
sheep(101103177) EH-domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014601 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014601 Rosetta Predictions human pricing
NM_001024897 Rosetta Predictions rat pricing
NM_153068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345885 predicted 406
2 SASI_Hs01_00127406 predicted 1237
3 SASI_Hs01_00127407 predicted 825
4 SASI_Hs01_00127409 predicted 906
5 SASI_Hs01_00127410 predicted 1390
6 SASI_Hs02_00345886 predicted 1328
7 SASI_Hs01_00127411 predicted 1855
8 SASI_Hs01_00127412 predicted 456
9 SASI_Hs01_00127413 predicted 610
10 SASI_Hs02_00345887 predicted 736
11 SASI_Hs01_00127405 predicted 1256
12 SASI_Hs01_00127408 predicted 1242
13 SASI_Hs01_00127414 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091142 predicted 477
2 SASI_Rn01_00091144 predicted 737
3 SASI_Rn01_00091146 predicted 1436
4 SASI_Rn01_00091147 predicted 434
5 SASI_Rn02_00202795 predicted 783
6 SASI_Rn01_00091148 predicted 1671
7 SASI_Rn01_00091149 predicted 876
8 SASI_Rn02_00202796 predicted 546
9 SASI_Rn01_00091150 predicted 213
10 SASI_Rn02_00202797 predicted 1173
11 SASI_Rn01_00091141 predicted 671
12 SASI_Rn01_00091143 predicted 1696
13 SASI_Rn01_00091145 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068924 predicted 1254
2 SASI_Mm01_00068925 predicted 1772
3 SASI_Mm01_00068926 predicted 825
4 SASI_Mm01_00068927 predicted 522
5 SASI_Mm01_00068928 predicted 303
6 SASI_Mm01_00068930 predicted 1326
7 SASI_Mm02_00342891 predicted 1760
8 SASI_Mm01_00068931 predicted 1218
9 SASI_Mm01_00068932 predicted 501
10 SASI_Mm02_00342892 predicted 755
11 SASI_Mm01_00068929 predicted 876
12 SASI_Mm01_00068933 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153068
VALIDATED
EHD2 MISSION shRNA Bacterial Glycerol Stock
EH-domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-1050s21c1
Sequence:CCGGAGCTCAACGACCTAGTGAAACCTCGAGGTTTCACTAGGTCGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-915s21c1
Sequence:CCGGAGGTCCTTCGCGTCTACATTGCTCGAGCAATGTAGACGCGAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-2087s21c1
Sequence:CCGGATCCATCCATCATTCATATAACTCGAGTTATATGAATGATGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-751s21c1
Sequence:CCGGGCTGGAGATTTCCGATGAATTCTCGAGAATTCATCGGAAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-1510s21c1
Sequence:CCGGGACCAAGGACAAGTCCAAATACTCGAGTATTTGGACTTGTCCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153068.1-2455s1c1
Sequence:CCGGGCAGGGTATAACCTATATTTACTCGAGTAAATATAGGTTATACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1197s1c1
Sequence:CCGGCCCAAGACATTGCCAAGCTTACTCGAGTAAGCTTGGCAATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1539s1c1
Sequence:CCGGGCAACTCAGCTAGAAGAACATCTCGAGATGTTCTTCTAGCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1384s1c1
Sequence:CCGGCAAGTCCAAATACGATGAAATCTCGAGATTTCATCGTATTTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153068.1-616s1c1
Sequence:CCGGGCTGGAGATTTCCGATGAATTCTCGAGAATTCATCGGAAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153068
VALIDATED
EHD2 MISSION shRNA shRNA Plasmid DNA
EH-domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-1050s21c1
Sequence:CCGGAGCTCAACGACCTAGTGAAACCTCGAGGTTTCACTAGGTCGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-915s21c1
Sequence:CCGGAGGTCCTTCGCGTCTACATTGCTCGAGCAATGTAGACGCGAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-2087s21c1
Sequence:CCGGATCCATCCATCATTCATATAACTCGAGTTATATGAATGATGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-751s21c1
Sequence:CCGGGCTGGAGATTTCCGATGAATTCTCGAGAATTCATCGGAAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-1510s21c1
Sequence:CCGGGACCAAGGACAAGTCCAAATACTCGAGTATTTGGACTTGTCCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153068.1-2455s1c1
Sequence:CCGGGCAGGGTATAACCTATATTTACTCGAGTAAATATAGGTTATACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1197s1c1
Sequence:CCGGCCCAAGACATTGCCAAGCTTACTCGAGTAAGCTTGGCAATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1539s1c1
Sequence:CCGGGCAACTCAGCTAGAAGAACATCTCGAGATGTTCTTCTAGCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1384s1c1
Sequence:CCGGCAAGTCCAAATACGATGAAATCTCGAGATTTCATCGTATTTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153068.1-616s1c1
Sequence:CCGGGCTGGAGATTTCCGATGAATTCTCGAGAATTCATCGGAAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153068
VALIDATED
EHD2 MISSION shRNA Lentiviral Transduction Particles
EH-domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-1050s21c1
Sequence:CCGGAGCTCAACGACCTAGTGAAACCTCGAGGTTTCACTAGGTCGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-915s21c1
Sequence:CCGGAGGTCCTTCGCGTCTACATTGCTCGAGCAATGTAGACGCGAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-2087s21c1
Sequence:CCGGATCCATCCATCATTCATATAACTCGAGTTATATGAATGATGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-751s21c1
Sequence:CCGGGCTGGAGATTTCCGATGAATTCTCGAGAATTCATCGGAAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153068.3-1510s21c1
Sequence:CCGGGACCAAGGACAAGTCCAAATACTCGAGTATTTGGACTTGTCCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153068.1-2455s1c1
Sequence:CCGGGCAGGGTATAACCTATATTTACTCGAGTAAATATAGGTTATACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1197s1c1
Sequence:CCGGCCCAAGACATTGCCAAGCTTACTCGAGTAAGCTTGGCAATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1539s1c1
Sequence:CCGGGCAACTCAGCTAGAAGAACATCTCGAGATGTTCTTCTAGCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153068.1-1384s1c1
Sequence:CCGGCAAGTCCAAATACGATGAAATCTCGAGATTTCATCGTATTTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153068.1-616s1c1
Sequence:CCGGGCTGGAGATTTCCGATGAATTCTCGAGAATTCATCGGAAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014601
VALIDATED
EHD2 MISSION shRNA Bacterial Glycerol Stock
EH-domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-618s21c1
Sequence:CCGGGCAAACTCAACCCTTTCGGAACTCGAGTTCCGAAAGGGTTGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-1255s21c1
Sequence:CCGGGCCCGTCATCTTTGCGAAGATCTCGAGATCTTCGCAAAGATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-1343s21c1
Sequence:CCGGGCGCACGACTTCACCAAGTTTCTCGAGAAACTTGGTGAAGTCGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-2153s21c1
Sequence:CCGGATCCGTCATTCATTCAAATATCTCGAGATATTTGAATGAATGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1254s1c1
Sequence:CCGGGCGCATGACTTCACCAAGTTTCTCGAGAAACTTGGTGAAGTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1508s1c1
Sequence:CCGGCAAGTCCAAATACGACGAGATCTCGAGATCTCGTCGTATTTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1166s1c1
Sequence:CCGGGCCCGTCATCTTTGCGAAGATCTCGAGATCTTCGCAAAGATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-529s1c1
Sequence:CCGGGCAAACTCAACCCTTTCGGAACTCGAGTTCCGAAAGGGTTGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014601.2-1073s1c1
Sequence:CCGGGCGAGTTCACGCTTACATCATCTCGAGATGATGTAAGCGTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1073s1c2
Sequence:CCGGGCGAGTTCACGCTTACATCATCTCGAGATGATGTAAGCGTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014601
VALIDATED
EHD2 MISSION shRNA shRNA Plasmid DNA
EH-domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-618s21c1
Sequence:CCGGGCAAACTCAACCCTTTCGGAACTCGAGTTCCGAAAGGGTTGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-1255s21c1
Sequence:CCGGGCCCGTCATCTTTGCGAAGATCTCGAGATCTTCGCAAAGATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-1343s21c1
Sequence:CCGGGCGCACGACTTCACCAAGTTTCTCGAGAAACTTGGTGAAGTCGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-2153s21c1
Sequence:CCGGATCCGTCATTCATTCAAATATCTCGAGATATTTGAATGAATGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1254s1c1
Sequence:CCGGGCGCATGACTTCACCAAGTTTCTCGAGAAACTTGGTGAAGTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1508s1c1
Sequence:CCGGCAAGTCCAAATACGACGAGATCTCGAGATCTCGTCGTATTTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1166s1c1
Sequence:CCGGGCCCGTCATCTTTGCGAAGATCTCGAGATCTTCGCAAAGATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-529s1c1
Sequence:CCGGGCAAACTCAACCCTTTCGGAACTCGAGTTCCGAAAGGGTTGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014601.2-1073s1c1
Sequence:CCGGGCGAGTTCACGCTTACATCATCTCGAGATGATGTAAGCGTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1073s1c2
Sequence:CCGGGCGAGTTCACGCTTACATCATCTCGAGATGATGTAAGCGTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014601
VALIDATED
EHD2 MISSION shRNA Lentiviral Transduction Particles
EH-domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-618s21c1
Sequence:CCGGGCAAACTCAACCCTTTCGGAACTCGAGTTCCGAAAGGGTTGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-1255s21c1
Sequence:CCGGGCCCGTCATCTTTGCGAAGATCTCGAGATCTTCGCAAAGATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-1343s21c1
Sequence:CCGGGCGCACGACTTCACCAAGTTTCTCGAGAAACTTGGTGAAGTCGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014601.3-2153s21c1
Sequence:CCGGATCCGTCATTCATTCAAATATCTCGAGATATTTGAATGAATGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1254s1c1
Sequence:CCGGGCGCATGACTTCACCAAGTTTCTCGAGAAACTTGGTGAAGTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1508s1c1
Sequence:CCGGCAAGTCCAAATACGACGAGATCTCGAGATCTCGTCGTATTTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1166s1c1
Sequence:CCGGGCCCGTCATCTTTGCGAAGATCTCGAGATCTTCGCAAAGATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-529s1c1
Sequence:CCGGGCAAACTCAACCCTTTCGGAACTCGAGTTCCGAAAGGGTTGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014601.2-1073s1c1
Sequence:CCGGGCGAGTTCACGCTTACATCATCTCGAGATGATGTAAGCGTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014601.2-1073s1c2
Sequence:CCGGGCGAGTTCACGCTTACATCATCTCGAGATGATGTAAGCGTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks