EMAIL THIS PAGE TO A FRIEND

EHD3

EH-domain containing 3

116 Gene Product Result for
Synonyms: PAST3
UniProtKB ID: Q9NZN3, D6W574, Q8N514, Q9NZB3
Gene ID:
Mouse(57440) EH-domain containing 3
Rat(192249) EH-domain containing 3
sheep(101104895) EH-domain containing 3
Domestic Rabbit(100344135) EH-domain containing 3
domestic guinea pig(100731115) EH-domain containing 3
naked mole-rat(101707648) EH-domain containing 3
Zebrafish(562949) EH-domain containing 3
cow(510183) EH-domain containing 3
Horse(100070691) EH-domain containing 3
domestic cat(101089434) EH-domain containing 3
dog(611260) EH-domain containing 3
chicken(421306) EH-domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014600 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123911 MISSION® esiRNA esiRNA human EHD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014600 Rosetta Predictions human pricing
NM_138890 Rosetta Predictions rat pricing
NM_020578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241701 predicted 1615
2 SASI_Hs01_00241702 predicted 1109
3 SASI_Hs01_00241704 predicted 2318
4 SASI_Hs01_00241705 predicted 2347
5 SASI_Hs01_00241706 predicted 2317
6 SASI_Hs01_00241707 predicted 2284
7 SASI_Hs01_00241708 predicted 1144
8 SASI_Hs01_00241709 predicted 2336
9 SASI_Hs01_00241710 predicted 562
10 SASI_Hs02_00345884 predicted 2342
11 SASI_Hs01_00241703 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268329 predicted 1029
2 SASI_Rn02_00268330 predicted 676
3 SASI_Rn01_00037157 predicted 1246
4 SASI_Rn02_00268331 predicted 667
5 SASI_Rn02_00268332 predicted 986
6 SASI_Rn02_00268333 predicted 460
7 SASI_Rn01_00037159 predicted 1218
8 SASI_Rn01_00037161 predicted 1411
9 SASI_Rn01_00037162 predicted 1232
10 SASI_Rn02_00268334 predicted 1006
11 SASI_Rn01_00037156 predicted 1203
12 SASI_Rn01_00037158 predicted 1739
13 SASI_Rn01_00037160 predicted 1736
14 SASI_Rn01_00037163 predicted 1277
15 SASI_Rn01_00037164 predicted 1356
16 SASI_Rn01_00037165 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102287 predicted 646
2 SASI_Mm01_00102288 predicted 998
3 SASI_Mm01_00102289 predicted 1518
4 SASI_Mm01_00102290 predicted 1227
5 SASI_Mm01_00102291 predicted 1171
6 SASI_Mm01_00102292 predicted 987
7 SASI_Mm01_00102293 predicted 1390
8 SASI_Mm01_00102294 predicted 1596
9 SASI_Mm01_00102295 predicted 1479
10 SASI_Mm01_00102296 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014600
EHD3 MISSION shRNA Bacterial Glycerol Stock
EH-domain containing 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-880s1c2
Sequence:CCGGGAGTTCTCAGAAGTCATCAAACTCGAGTTTGATGACTTCTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014600.1-2442s1c1
Sequence:CCGGGCTCTGTTCTTTCCTAATCTACTCGAGTAGATTAGGAAAGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-360s1c1
Sequence:CCGGCAAGAAACTCTACAAGAGCAACTCGAGTTGCTCTTGTAGAGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-1446s1c1
Sequence:CCGGCCATGACATTGCCCAGCTCATCTCGAGATGAGCTGGGCAATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-880s1c1
Sequence:CCGGGAGTTCTCAGAAGTCATCAAACTCGAGTTTGATGACTTCTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-637s1c1
Sequence:CCGGCCCAAGAAACCCTTCAGGAAACTCGAGTTTCCTGAAGGGTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014600
EHD3 MISSION shRNA shRNA Plasmid DNA
EH-domain containing 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-880s1c2
Sequence:CCGGGAGTTCTCAGAAGTCATCAAACTCGAGTTTGATGACTTCTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014600.1-2442s1c1
Sequence:CCGGGCTCTGTTCTTTCCTAATCTACTCGAGTAGATTAGGAAAGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-360s1c1
Sequence:CCGGCAAGAAACTCTACAAGAGCAACTCGAGTTGCTCTTGTAGAGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-1446s1c1
Sequence:CCGGCCATGACATTGCCCAGCTCATCTCGAGATGAGCTGGGCAATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-880s1c1
Sequence:CCGGGAGTTCTCAGAAGTCATCAAACTCGAGTTTGATGACTTCTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-637s1c1
Sequence:CCGGCCCAAGAAACCCTTCAGGAAACTCGAGTTTCCTGAAGGGTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014600
EHD3 MISSION shRNA Lentiviral Transduction Particles
EH-domain containing 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-880s1c2
Sequence:CCGGGAGTTCTCAGAAGTCATCAAACTCGAGTTTGATGACTTCTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014600.1-2442s1c1
Sequence:CCGGGCTCTGTTCTTTCCTAATCTACTCGAGTAGATTAGGAAAGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-360s1c1
Sequence:CCGGCAAGAAACTCTACAAGAGCAACTCGAGTTGCTCTTGTAGAGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-1446s1c1
Sequence:CCGGCCATGACATTGCCCAGCTCATCTCGAGATGAGCTGGGCAATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-880s1c1
Sequence:CCGGGAGTTCTCAGAAGTCATCAAACTCGAGTTTGATGACTTCTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014600.1-637s1c1
Sequence:CCGGCCCAAGAAACCCTTCAGGAAACTCGAGTTTCCTGAAGGGTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020578
VALIDATED
EHD3 MISSION shRNA Bacterial Glycerol Stock
EH-domain containing 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-3247s1c1
Sequence:CCGGCCTCCCGTTCATTAGCCTAAACTCGAGTTTAGGCTAATGAACGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-1705s1c1
Sequence:CCGGCAAGCCTATGTATGATGAGATCTCGAGATCTCATCATACATAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020578.1-526s1c1
Sequence:CCGGAGATGCTGATTTCGACAACAACTCGAGTTGTTGTCGAAATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020578.1-1952s1c1
Sequence:CCGGCCTCCATATAAGAGGAAAGTACTCGAGTACTTTCCTCTTATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-1837s1c1
Sequence:CCGGCGACATTGACAAGGATGGCATCTCGAGATGCCATCCTTGTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1043s21c1
Sequence:CCGGTGCGCGTAGTGTTGAACAAAGCTCGAGCTTTGTTCAACACTACGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1400s21c1
Sequence:CCGGACAACCTGGCTGAGATCTATGCTCGAGCATAGATCTCAGCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-3272s21c1
Sequence:CCGGCCTCCCGTTCATTAGCCTAAACTCGAGTTTAGGCTAATGAACGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020578.3-1866s21c1
Sequence:CCGGCGACATTGACAAGGATGGCATCTCGAGATGCCATCCTTGTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-894s21c1
Sequence:CCGGGATCAGCCGAGGGTATGATTTCTCGAGAAATCATACCCTCGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1624s21c1
Sequence:CCGGATGGTGAAGGGCGGAGCATTTCTCGAGAAATGCTCCGCCCTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020578
VALIDATED
EHD3 MISSION shRNA shRNA Plasmid DNA
EH-domain containing 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-3247s1c1
Sequence:CCGGCCTCCCGTTCATTAGCCTAAACTCGAGTTTAGGCTAATGAACGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-1705s1c1
Sequence:CCGGCAAGCCTATGTATGATGAGATCTCGAGATCTCATCATACATAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020578.1-526s1c1
Sequence:CCGGAGATGCTGATTTCGACAACAACTCGAGTTGTTGTCGAAATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020578.1-1952s1c1
Sequence:CCGGCCTCCATATAAGAGGAAAGTACTCGAGTACTTTCCTCTTATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-1837s1c1
Sequence:CCGGCGACATTGACAAGGATGGCATCTCGAGATGCCATCCTTGTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1043s21c1
Sequence:CCGGTGCGCGTAGTGTTGAACAAAGCTCGAGCTTTGTTCAACACTACGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1400s21c1
Sequence:CCGGACAACCTGGCTGAGATCTATGCTCGAGCATAGATCTCAGCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-3272s21c1
Sequence:CCGGCCTCCCGTTCATTAGCCTAAACTCGAGTTTAGGCTAATGAACGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020578.3-1866s21c1
Sequence:CCGGCGACATTGACAAGGATGGCATCTCGAGATGCCATCCTTGTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-894s21c1
Sequence:CCGGGATCAGCCGAGGGTATGATTTCTCGAGAAATCATACCCTCGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1624s21c1
Sequence:CCGGATGGTGAAGGGCGGAGCATTTCTCGAGAAATGCTCCGCCCTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020578
VALIDATED
EHD3 MISSION shRNA Lentiviral Transduction Particles
EH-domain containing 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-3247s1c1
Sequence:CCGGCCTCCCGTTCATTAGCCTAAACTCGAGTTTAGGCTAATGAACGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-1705s1c1
Sequence:CCGGCAAGCCTATGTATGATGAGATCTCGAGATCTCATCATACATAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020578.1-526s1c1
Sequence:CCGGAGATGCTGATTTCGACAACAACTCGAGTTGTTGTCGAAATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020578.1-1952s1c1
Sequence:CCGGCCTCCATATAAGAGGAAAGTACTCGAGTACTTTCCTCTTATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020578.1-1837s1c1
Sequence:CCGGCGACATTGACAAGGATGGCATCTCGAGATGCCATCCTTGTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1043s21c1
Sequence:CCGGTGCGCGTAGTGTTGAACAAAGCTCGAGCTTTGTTCAACACTACGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1400s21c1
Sequence:CCGGACAACCTGGCTGAGATCTATGCTCGAGCATAGATCTCAGCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-3272s21c1
Sequence:CCGGCCTCCCGTTCATTAGCCTAAACTCGAGTTTAGGCTAATGAACGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020578.3-1866s21c1
Sequence:CCGGCGACATTGACAAGGATGGCATCTCGAGATGCCATCCTTGTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-894s21c1
Sequence:CCGGGATCAGCCGAGGGTATGATTTCTCGAGAAATCATACCCTCGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020578.3-1624s21c1
Sequence:CCGGATGGTGAAGGGCGGAGCATTTCTCGAGAAATGCTCCGCCCTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks