EMAIL THIS PAGE TO A FRIEND

EHD4

EH-domain containing 4

49 Gene Product Result for
Synonyms: PAST4
UniProtKB ID: Q9H223, Q9HAR1, Q9NZN2
Gene ID:
Mouse(98878) EH-domain containing 4
Rat(192204) EH-domain containing 4
dog(608795) EH-domain containing 4
cow(505206) EH-domain containing 4
domestic cat(101083087) EH-domain containing 4
naked mole-rat(101705478) EH-domain containing 4
domestic guinea pig(100734560) EH-domain containing 4
sheep(101115625) EH-domain containing 4
Domestic Rabbit(100345191) EH-domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139265 Rosetta Predictions human pricing
NM_139324 Rosetta Predictions rat pricing
NM_133838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139749 predicted 643
2 SASI_Hs01_00139750 predicted 345
3 SASI_Hs01_00139751 predicted 2144
4 SASI_Hs01_00139752 predicted 798
5 SASI_Hs01_00139753 predicted 1146
6 SASI_Hs01_00139754 predicted 1077
7 SASI_Hs01_00139755 predicted 2146
8 SASI_Hs01_00139756 predicted 1120
9 SASI_Hs01_00139757 predicted 645
10 SASI_Hs01_00139758 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082830 predicted 249
2 SASI_Rn01_00082831 predicted 734
3 SASI_Rn01_00082833 predicted 238
4 SASI_Rn01_00082834 predicted 248
5 SASI_Rn01_00082835 predicted 514
6 SASI_Rn01_00082836 predicted 367
7 SASI_Rn01_00082837 predicted 1408
8 SASI_Rn01_00082838 predicted 363
9 SASI_Rn01_00082839 predicted 1174
10 SASI_Rn02_00268559 predicted 1213
11 SASI_Rn01_00082832 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152759 predicted 329
2 SASI_Mm01_00152760 predicted 849
3 SASI_Mm01_00152762 predicted 1437
4 SASI_Mm01_00152763 predicted 389
5 SASI_Mm01_00152764 predicted 602
6 SASI_Mm01_00152765 predicted 442
7 SASI_Mm01_00152767 predicted 443
8 SASI_Mm01_00152768 predicted 1255
9 SASI_Mm02_00338878 predicted 993
10 SASI_Mm02_00338879 predicted 833
11 SASI_Mm01_00152761 predicted 379
12 SASI_Mm01_00152766 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139265
EHD4 MISSION shRNA Bacterial Glycerol Stock
EH-domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139265.3-359s21c1
Sequence:CCGGCCTTCATCGCCGTGATGTATGCTCGAGCATACATCACGGCGATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139265.3-1746s21c1
Sequence:CCGGACCACTGACTCACCGAATGACCTCGAGGTCATTCGGTGAGTCAGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139265.3-1067s21c1
Sequence:CCGGTCAGCAGGCTACCGGAAATCTCTCGAGAGATTTCCGGTAGCCTGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1426s1c1
Sequence:CCGGCGCCCATCAATGGCAAGATATCTCGAGATATCTTGCCATTGATGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1014s1c1
Sequence:CCGGCCAAGTGTATTTGGAAAGGAACTCGAGTTCCTTTCCAAATACACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-434s1c1
Sequence:CCGGCAGTCGCTTTGGAAACGCTTTCTCGAGAAAGCGTTTCCAAAGCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1137s1c1
Sequence:CCGGCAGGAACAGCTTGAGAACTATCTCGAGATAGTTCTCAAGCTGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-285s1c1
Sequence:CCGGAGATACCTACTGGAGCAGGATCTCGAGATCCTGCTCCAGTAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139265
EHD4 MISSION shRNA shRNA Plasmid DNA
EH-domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139265.3-359s21c1
Sequence:CCGGCCTTCATCGCCGTGATGTATGCTCGAGCATACATCACGGCGATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139265.3-1746s21c1
Sequence:CCGGACCACTGACTCACCGAATGACCTCGAGGTCATTCGGTGAGTCAGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139265.3-1067s21c1
Sequence:CCGGTCAGCAGGCTACCGGAAATCTCTCGAGAGATTTCCGGTAGCCTGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1426s1c1
Sequence:CCGGCGCCCATCAATGGCAAGATATCTCGAGATATCTTGCCATTGATGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1014s1c1
Sequence:CCGGCCAAGTGTATTTGGAAAGGAACTCGAGTTCCTTTCCAAATACACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-434s1c1
Sequence:CCGGCAGTCGCTTTGGAAACGCTTTCTCGAGAAAGCGTTTCCAAAGCGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1137s1c1
Sequence:CCGGCAGGAACAGCTTGAGAACTATCTCGAGATAGTTCTCAAGCTGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-285s1c1
Sequence:CCGGAGATACCTACTGGAGCAGGATCTCGAGATCCTGCTCCAGTAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139265
EHD4 MISSION shRNA Lentiviral Transduction Particles
EH-domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139265.3-359s21c1
Sequence:CCGGCCTTCATCGCCGTGATGTATGCTCGAGCATACATCACGGCGATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139265.3-1746s21c1
Sequence:CCGGACCACTGACTCACCGAATGACCTCGAGGTCATTCGGTGAGTCAGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139265.3-1067s21c1
Sequence:CCGGTCAGCAGGCTACCGGAAATCTCTCGAGAGATTTCCGGTAGCCTGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1426s1c1
Sequence:CCGGCGCCCATCAATGGCAAGATATCTCGAGATATCTTGCCATTGATGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1014s1c1
Sequence:CCGGCCAAGTGTATTTGGAAAGGAACTCGAGTTCCTTTCCAAATACACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-434s1c1
Sequence:CCGGCAGTCGCTTTGGAAACGCTTTCTCGAGAAAGCGTTTCCAAAGCGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-1137s1c1
Sequence:CCGGCAGGAACAGCTTGAGAACTATCTCGAGATAGTTCTCAAGCTGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139265.2-285s1c1
Sequence:CCGGAGATACCTACTGGAGCAGGATCTCGAGATCCTGCTCCAGTAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133838
VALIDATED
EHD4 MISSION shRNA Bacterial Glycerol Stock
EH-domain containing 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133838.4-3136s21c1
Sequence:CCGGGCCACCATTCACACTTCCTATCTCGAGATAGGAAGTGTGAATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-860s21c1
Sequence:CCGGCGAGTCTACATTGGTTCATTTCTCGAGAAATGAACCAATGTAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-1621s21c1
Sequence:CCGGCAAGCACCTCATCAAGATCAACTCGAGTTGATCTTGATGAGGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-1445s21c1
Sequence:CCGGCCGGTGTATGACGAACTCTTTCTCGAGAAAGAGTTCGTCATACACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-3176s1c1
Sequence:CCGGGCCACCATTCACACTTCCTATCTCGAGATAGGAAGTGTGAATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133838.2-1485s1c1
Sequence:CCGGCCGGTGTATGACGAACTCTTTCTCGAGAAAGAGTTCGTCATACACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-486s1c1
Sequence:CCGGGCTTTAGTTGTGGATCCCAAACTCGAGTTTGGGATCCACAACTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-1661s1c1
Sequence:CCGGCAAGCACCTCATCAAGATCAACTCGAGTTGATCTTGATGAGGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-900s1c1
Sequence:CCGGCGAGTCTACATTGGTTCATTTCTCGAGAAATGAACCAATGTAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133838
VALIDATED
EHD4 MISSION shRNA shRNA Plasmid DNA
EH-domain containing 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133838.4-3136s21c1
Sequence:CCGGGCCACCATTCACACTTCCTATCTCGAGATAGGAAGTGTGAATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-860s21c1
Sequence:CCGGCGAGTCTACATTGGTTCATTTCTCGAGAAATGAACCAATGTAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-1621s21c1
Sequence:CCGGCAAGCACCTCATCAAGATCAACTCGAGTTGATCTTGATGAGGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-1445s21c1
Sequence:CCGGCCGGTGTATGACGAACTCTTTCTCGAGAAAGAGTTCGTCATACACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-3176s1c1
Sequence:CCGGGCCACCATTCACACTTCCTATCTCGAGATAGGAAGTGTGAATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133838.2-1485s1c1
Sequence:CCGGCCGGTGTATGACGAACTCTTTCTCGAGAAAGAGTTCGTCATACACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-486s1c1
Sequence:CCGGGCTTTAGTTGTGGATCCCAAACTCGAGTTTGGGATCCACAACTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-1661s1c1
Sequence:CCGGCAAGCACCTCATCAAGATCAACTCGAGTTGATCTTGATGAGGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-900s1c1
Sequence:CCGGCGAGTCTACATTGGTTCATTTCTCGAGAAATGAACCAATGTAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133838
VALIDATED
EHD4 MISSION shRNA Lentiviral Transduction Particles
EH-domain containing 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133838.4-3136s21c1
Sequence:CCGGGCCACCATTCACACTTCCTATCTCGAGATAGGAAGTGTGAATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-860s21c1
Sequence:CCGGCGAGTCTACATTGGTTCATTTCTCGAGAAATGAACCAATGTAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-1621s21c1
Sequence:CCGGCAAGCACCTCATCAAGATCAACTCGAGTTGATCTTGATGAGGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133838.4-1445s21c1
Sequence:CCGGCCGGTGTATGACGAACTCTTTCTCGAGAAAGAGTTCGTCATACACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-3176s1c1
Sequence:CCGGGCCACCATTCACACTTCCTATCTCGAGATAGGAAGTGTGAATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133838.2-1485s1c1
Sequence:CCGGCCGGTGTATGACGAACTCTTTCTCGAGAAAGAGTTCGTCATACACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-486s1c1
Sequence:CCGGGCTTTAGTTGTGGATCCCAAACTCGAGTTTGGGATCCACAACTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-1661s1c1
Sequence:CCGGCAAGCACCTCATCAAGATCAACTCGAGTTGATCTTGATGAGGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133838.2-900s1c1
Sequence:CCGGCGAGTCTACATTGGTTCATTTCTCGAGAAATGAACCAATGTAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)