EMAIL THIS PAGE TO A FRIEND

EHHADH

enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase

56 Gene Product Result for
Synonyms: ECHD L-PBE LBFP LBP PBFE
UniProtKB ID: Q08426, A8K6Y3, B4DWG3, D3DNU0, Q58EZ5
Gene ID:
Human(1962) Summary: The protein encoded by this gene is a bifunctional enzyme and is one of the four enzymes of the peroxisomal beta-oxidation pathway. The N-terminal region of the encoded protein contains enoyl-CoA hydratase activity while the C-terminal region contains 3-hydroxyacyl-CoA dehydrogenase activity. Defects in this gene are a cause of peroxisomal disorders such as Zellweger syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(74147) enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
Rat(171142) enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Zebrafish(100000859) enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
chicken(424877) enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
cow(518852) enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Horse(100067714) enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
domestic cat(101083876) enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
dog(488110) enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
naked mole-rat(101699730) enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
sheep(101117635) enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Gene Class: Dehydratase, Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001966 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001966 Rosetta Predictions human pricing
NM_133606 Rosetta Predictions rat pricing
NM_023737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030722 predicted 1334
2 SASI_Hs01_00030723 predicted 630
3 SASI_Hs01_00030724 predicted 1848
4 SASI_Hs01_00030725 predicted 1499
5 SASI_Hs01_00030726 predicted 239
6 SASI_Hs01_00030728 predicted 982
7 SASI_Hs01_00030729 predicted 825
8 SASI_Hs01_00030730 predicted 1633
9 SASI_Hs02_00332923 predicted 2040
10 SASI_Hs02_00332924 predicted 2283
11 SASI_Hs01_00030727 predicted 525
12 SASI_Hs01_00030731 predicted 2232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088578 predicted 1262
2 SASI_Rn01_00088579 predicted 1747
3 SASI_Rn01_00088580 predicted 1709
4 SASI_Rn01_00088581 predicted 1735
5 SASI_Rn01_00088582 predicted 1144
6 SASI_Rn01_00088583 predicted 1448
7 SASI_Rn01_00088584 predicted 1881
8 SASI_Rn01_00088586 predicted 622
9 SASI_Rn01_00088587 predicted 1456
10 SASI_Rn02_00267828 predicted 1385
11 SASI_Rn01_00088585 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072107 predicted 1438
2 SASI_Mm01_00072108 predicted 1700
3 SASI_Mm01_00072109 predicted 1948
4 SASI_Mm02_00327316 predicted 1749
5 SASI_Mm02_00327317 predicted 401
6 SASI_Mm01_00072110 predicted 1144
7 SASI_Mm01_00072112 predicted 2218
8 SASI_Mm01_00072113 predicted 1457
9 SASI_Mm01_00072114 predicted 1335
10 SASI_Mm01_00072115 predicted 2033
11 SASI_Mm01_00072111 predicted 1738
12 SASI_Mm01_00072116 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001966
VALIDATED
EHHADH MISSION shRNA Bacterial Glycerol Stock
enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-92s21c1
Sequence:CCGGACGCGATCAGTACGACTTTACCTCGAGGTAAAGTCGTACTGATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-178s21c1
Sequence:CCGGTGTGGAGCAGAGGGCAAATTTCTCGAGAAATTTGCCCTCTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001966.2-1488s21c1
Sequence:CCGGTTACTACAATCAGGCATATTTCTCGAGAAATATGCCTGATTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-2336s21c1
Sequence:CCGGTAACGACTCTAATGGTCAAATCTCGAGATTTGACCATTAGAGTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-482s21c1
Sequence:CCGGTTACCTCAGGAAGACGTATTTCTCGAGAAATACGTCTTCCTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-1345s21c1
Sequence:CCGGATGAAGTTGTTAGAGGTTATTCTCGAGAATAACCTCTAACAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-1699s1c1
Sequence:CCGGGCTCTGTGAATTAGGACGATTCTCGAGAATCGTCCTAATTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001966.1-933s1c1
Sequence:CCGGGCCGAGGCATTGTCATTTCTTCTCGAGAAGAAATGACAATGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-122s1c1
Sequence:CCGGGCTGGAAGAGACCATACAATACTCGAGTATTGTATGGTCTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001966.1-1466s1c1
Sequence:CCGGCCTTACTACAATCAGGCATATCTCGAGATATGCCTGATTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-537s1c1
Sequence:CCGGCGGTTGAAGAAGCAATCAGATCTCGAGATCTGATTGCTTCTTCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001966
VALIDATED
EHHADH MISSION shRNA shRNA Plasmid DNA
enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-92s21c1
Sequence:CCGGACGCGATCAGTACGACTTTACCTCGAGGTAAAGTCGTACTGATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-178s21c1
Sequence:CCGGTGTGGAGCAGAGGGCAAATTTCTCGAGAAATTTGCCCTCTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001966.2-1488s21c1
Sequence:CCGGTTACTACAATCAGGCATATTTCTCGAGAAATATGCCTGATTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-2336s21c1
Sequence:CCGGTAACGACTCTAATGGTCAAATCTCGAGATTTGACCATTAGAGTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-482s21c1
Sequence:CCGGTTACCTCAGGAAGACGTATTTCTCGAGAAATACGTCTTCCTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-1345s21c1
Sequence:CCGGATGAAGTTGTTAGAGGTTATTCTCGAGAATAACCTCTAACAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-1699s1c1
Sequence:CCGGGCTCTGTGAATTAGGACGATTCTCGAGAATCGTCCTAATTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001966.1-933s1c1
Sequence:CCGGGCCGAGGCATTGTCATTTCTTCTCGAGAAGAAATGACAATGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-122s1c1
Sequence:CCGGGCTGGAAGAGACCATACAATACTCGAGTATTGTATGGTCTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001966.1-1466s1c1
Sequence:CCGGCCTTACTACAATCAGGCATATCTCGAGATATGCCTGATTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-537s1c1
Sequence:CCGGCGGTTGAAGAAGCAATCAGATCTCGAGATCTGATTGCTTCTTCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001966
VALIDATED
EHHADH MISSION shRNA Lentiviral Transduction Particles
enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-92s21c1
Sequence:CCGGACGCGATCAGTACGACTTTACCTCGAGGTAAAGTCGTACTGATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-178s21c1
Sequence:CCGGTGTGGAGCAGAGGGCAAATTTCTCGAGAAATTTGCCCTCTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001966.2-1488s21c1
Sequence:CCGGTTACTACAATCAGGCATATTTCTCGAGAAATATGCCTGATTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-2336s21c1
Sequence:CCGGTAACGACTCTAATGGTCAAATCTCGAGATTTGACCATTAGAGTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-482s21c1
Sequence:CCGGTTACCTCAGGAAGACGTATTTCTCGAGAAATACGTCTTCCTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001966.2-1345s21c1
Sequence:CCGGATGAAGTTGTTAGAGGTTATTCTCGAGAATAACCTCTAACAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-1699s1c1
Sequence:CCGGGCTCTGTGAATTAGGACGATTCTCGAGAATCGTCCTAATTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001966.1-933s1c1
Sequence:CCGGGCCGAGGCATTGTCATTTCTTCTCGAGAAGAAATGACAATGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-122s1c1
Sequence:CCGGGCTGGAAGAGACCATACAATACTCGAGTATTGTATGGTCTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001966.1-1466s1c1
Sequence:CCGGCCTTACTACAATCAGGCATATCTCGAGATATGCCTGATTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001966.1-537s1c1
Sequence:CCGGCGGTTGAAGAAGCAATCAGATCTCGAGATCTGATTGCTTCTTCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023737
VALIDATED
EHHADH MISSION shRNA Bacterial Glycerol Stock
enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023737.3-196s21c1
Sequence:CCGGATAGTGATCTGTGGAGCAAATCTCGAGATTTGCTCCACAGATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023737.3-101s21c1
Sequence:CCGGTCTGCAATCCACCGGTCAATGCTCGAGCATTGACCGGTGGATTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023737.3-2233s21c1
Sequence:CCGGATGTATGGTGGCATCTAATTTCTCGAGAAATTAGATGCCACCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023737.2-551s1c1
Sequence:CCGGCCAGTTGAAGAAGCCATCAAACTCGAGTTTGATGGCTTCTTCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-1876s1c1
Sequence:CCGGGCGTTGCTTATATTCCCTTATCTCGAGATAAGGGAATATAAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-1472s1c1
Sequence:CCGGCCCTATTACAACCAGGGCTATCTCGAGATAGCCCTGGTTGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023737.2-480s1c1
Sequence:CCGGCCTCAGGAAGACATATTTCAACTCGAGTTGAAATATGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-2050s1c1
Sequence:CCGGGCAGAAATATTACAGACAGAACTCGAGTTCTGTCTGTAATATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023737
VALIDATED
EHHADH MISSION shRNA shRNA Plasmid DNA
enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023737.3-196s21c1
Sequence:CCGGATAGTGATCTGTGGAGCAAATCTCGAGATTTGCTCCACAGATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023737.3-101s21c1
Sequence:CCGGTCTGCAATCCACCGGTCAATGCTCGAGCATTGACCGGTGGATTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023737.3-2233s21c1
Sequence:CCGGATGTATGGTGGCATCTAATTTCTCGAGAAATTAGATGCCACCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023737.2-551s1c1
Sequence:CCGGCCAGTTGAAGAAGCCATCAAACTCGAGTTTGATGGCTTCTTCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-1876s1c1
Sequence:CCGGGCGTTGCTTATATTCCCTTATCTCGAGATAAGGGAATATAAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-1472s1c1
Sequence:CCGGCCCTATTACAACCAGGGCTATCTCGAGATAGCCCTGGTTGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023737.2-480s1c1
Sequence:CCGGCCTCAGGAAGACATATTTCAACTCGAGTTGAAATATGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-2050s1c1
Sequence:CCGGGCAGAAATATTACAGACAGAACTCGAGTTCTGTCTGTAATATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023737
VALIDATED
EHHADH MISSION shRNA Lentiviral Transduction Particles
enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023737.3-196s21c1
Sequence:CCGGATAGTGATCTGTGGAGCAAATCTCGAGATTTGCTCCACAGATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023737.3-101s21c1
Sequence:CCGGTCTGCAATCCACCGGTCAATGCTCGAGCATTGACCGGTGGATTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023737.3-2233s21c1
Sequence:CCGGATGTATGGTGGCATCTAATTTCTCGAGAAATTAGATGCCACCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023737.2-551s1c1
Sequence:CCGGCCAGTTGAAGAAGCCATCAAACTCGAGTTTGATGGCTTCTTCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-1876s1c1
Sequence:CCGGGCGTTGCTTATATTCCCTTATCTCGAGATAAGGGAATATAAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-1472s1c1
Sequence:CCGGCCCTATTACAACCAGGGCTATCTCGAGATAGCCCTGGTTGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023737.2-480s1c1
Sequence:CCGGCCTCAGGAAGACATATTTCAACTCGAGTTGAAATATGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023737.2-2050s1c1
Sequence:CCGGGCAGAAATATTACAGACAGAACTCGAGTTCTGTCTGTAATATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks