EMAIL THIS PAGE TO A FRIEND

EHMT1

euchromatic histone-lysine N-methyltransferase 1

129 Gene Product Result for
Synonyms: EUHMTASE1 Eu-HMTase1 FP13812 GLP GLP1 KMT1D bA188C12.1
Gene ID:
Human(79813) Summary: The protein encoded by this gene is a histone methyltransferase that is part of the E2F6 complex, which represses transcription. The encoded protein methylates the Lys-9 position of histone H3, which tags it for transcriptional repression. This protein may be involved in the silencing of MYC- and E2F-responsive genes and therefore could play a role in the G0/G1 cell cycle transition. Defects in this gene are a cause of chromosome 9q subtelomeric deletion syndrome (9q-syndrome). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(77683) euchromatic histone methyltransferase 1
Rat(362078) euchromatic histone-lysine N-methyltransferase 1
chicken(417250) euchromatic histone-lysine N-methyltransferase 1
dog(491224) euchromatic histone-lysine N-methyltransferase 1
domestic cat(101087111) euchromatic histone-lysine N-methyltransferase 1
cow(528606) euchromatic histone-lysine N-methyltransferase 1
Horse(100058869) euchromatic histone-lysine N-methyltransferase 1
sheep(101123545) euchromatic histone-lysine N-methyltransferase 1
domestic guinea pig(100735478) euchromatic histone-lysine N-methyltransferase 1
naked mole-rat(101699104) euchromatic histone-lysine N-methyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024757 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024757 Rosetta Predictions human pricing
NM_001108572 Rosetta Predictions rat pricing
NM_001012518 Rosetta Predictions mouse pricing
NM_001109686 Rosetta Predictions mouse pricing
NM_001109687 Rosetta Predictions mouse pricing
NM_172545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022761 predicted 922
2 SASI_Hs01_00022762 predicted 1818
3 SASI_Hs01_00022763 predicted 3464
4 SASI_Hs02_00357259 predicted 3493
5 SASI_Hs01_00022764 predicted 3421
6 SASI_Hs01_00022765 predicted 912
7 SASI_Hs01_00022766 predicted 1237
8 SASI_Hs01_00022767 predicted 1619
9 SASI_Hs01_00022769 predicted 2520
10 SASI_Hs01_00022770 predicted 234
11 SASI_Hs01_00022768 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239959 predicted 653
2 SASI_Rn02_00239960 predicted 2919
3 SASI_Rn02_00239961 predicted 708
4 SASI_Rn02_00239962 predicted 272
5 SASI_Rn02_00239963 predicted 3438
6 SASI_Rn02_00239964 predicted 3093
7 SASI_Rn02_00239965 predicted 2474
8 SASI_Rn02_00239966 predicted 1234
9 SASI_Rn02_00239967 predicted 795
10 SASI_Rn02_00239968 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090079 predicted 2282
2 SASI_Mm01_00090080 predicted 3007
3 SASI_Mm01_00090081 predicted 2174
4 SASI_Mm02_00287121 predicted 3126
5 SASI_Mm01_00090083 predicted 3519
6 SASI_Mm01_00090084 predicted 2555
7 SASI_Mm02_00287122 predicted 3052
8 SASI_Mm01_00090087 predicted 3037
9 SASI_Mm02_00287123 predicted 1119
10 SASI_Mm01_00090088 predicted 2757
11 SASI_Mm01_00090082 predicted 1698
12 SASI_Mm01_00090085 predicted 1973
13 SASI_Mm01_00090086 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304144 predicted 2125
2 SASI_Mm02_00304145 predicted 2845
3 SASI_Mm02_00304146 predicted 2016
4 SASI_Mm02_00304147 predicted 2958
5 SASI_Mm02_00304148 predicted 3359
6 SASI_Mm02_00304149 predicted 2403
7 SASI_Mm02_00304150 predicted 2893
8 SASI_Mm02_00304151 predicted 2878
9 SASI_Mm02_00304152 predicted 1102
10 SASI_Mm02_00304153 predicted 2605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304154 predicted 2146
2 SASI_Mm02_00304155 predicted 2857
3 SASI_Mm02_00304156 predicted 2024
4 SASI_Mm02_00304157 predicted 2980
5 SASI_Mm02_00304158 predicted 3376
6 SASI_Mm02_00304159 predicted 2410
7 SASI_Mm02_00304160 predicted 2909
8 SASI_Mm02_00304161 predicted 2894
9 SASI_Mm02_00304162 predicted 1122
10 SASI_Mm02_00304163 predicted 2614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067626 predicted 2260
2 SASI_Mm01_00067627 predicted 2985
3 SASI_Mm01_00067628 predicted 2149
4 SASI_Mm02_00344155 predicted 3100
5 SASI_Mm01_00067630 predicted 3503
6 SASI_Mm01_00067631 predicted 2539
7 SASI_Mm02_00344156 predicted 3030
8 SASI_Mm01_00067633 predicted 3019
9 SASI_Mm02_00344157 predicted 1098
10 SASI_Mm01_00067634 predicted 2743
11 SASI_Mm01_00067629 predicted 1690
12 SASI_Mm01_00067632 predicted 1957
13 SASI_Mm01_00067635 predicted 1662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024757
VALIDATED
EHMT1 MISSION shRNA Bacterial Glycerol Stock
euchromatic histone-lysine N-methyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_024757.3-1839s1c1
Sequence:CCGGCGAGTCAATAACGCCAGCTATCTCGAGATAGCTGGCGTTATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-3500s1c1
Sequence:CCGGCCTCTTTGATCTCGACAATAACTCGAGTTATTGTCGAGATCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024757.3-1346s1c1
Sequence:CCGGCCTCGGTTCTGAGTCGTATAACTCGAGTTATACGACTCAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-3126s1c1
Sequence:CCGGCCCATGAACATCGACAGAAATCTCGAGATTTCTGTCGATGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-346s1c1
Sequence:CCGGGCAACGGATACATCTTAAATACTCGAGTATTTAAGATGTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-1346s21c1
Sequence:CCGGCCTCGGTTCTGAGTCGTATAACTCGAGTTATACGACTCAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024757.3-4777s21c1
Sequence:CCGGGTTAGTCTTGTAGCGTGAATACTCGAGTATTCACGCTACAAGACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-653s21c1
Sequence:GTACCGGTCGAGAAGCTAGAGATCATAACTCGAGTTATGATCTCTAGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-3499s21c1
Sequence:GTACCGGACCTCTTTGATCTCGACAATACTCGAGTATTGTCGAGATCAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-2864s21c1
Sequence:CCGGGGATTCAGATGTCACCTTAAACTCGAGTTTAAGGTGACATCTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024757
VALIDATED
EHMT1 MISSION shRNA shRNA Plasmid DNA
euchromatic histone-lysine N-methyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_024757.3-1839s1c1
Sequence:CCGGCGAGTCAATAACGCCAGCTATCTCGAGATAGCTGGCGTTATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-3500s1c1
Sequence:CCGGCCTCTTTGATCTCGACAATAACTCGAGTTATTGTCGAGATCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024757.3-1346s1c1
Sequence:CCGGCCTCGGTTCTGAGTCGTATAACTCGAGTTATACGACTCAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-3126s1c1
Sequence:CCGGCCCATGAACATCGACAGAAATCTCGAGATTTCTGTCGATGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-346s1c1
Sequence:CCGGGCAACGGATACATCTTAAATACTCGAGTATTTAAGATGTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-1346s21c1
Sequence:CCGGCCTCGGTTCTGAGTCGTATAACTCGAGTTATACGACTCAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024757.3-4777s21c1
Sequence:CCGGGTTAGTCTTGTAGCGTGAATACTCGAGTATTCACGCTACAAGACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-653s21c1
Sequence:GTACCGGTCGAGAAGCTAGAGATCATAACTCGAGTTATGATCTCTAGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-3499s21c1
Sequence:GTACCGGACCTCTTTGATCTCGACAATACTCGAGTATTGTCGAGATCAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-2864s21c1
Sequence:CCGGGGATTCAGATGTCACCTTAAACTCGAGTTTAAGGTGACATCTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024757
VALIDATED
EHMT1 MISSION shRNA Lentiviral Transduction Particles
euchromatic histone-lysine N-methyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_024757.3-1839s1c1
Sequence:CCGGCGAGTCAATAACGCCAGCTATCTCGAGATAGCTGGCGTTATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-3500s1c1
Sequence:CCGGCCTCTTTGATCTCGACAATAACTCGAGTTATTGTCGAGATCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024757.3-1346s1c1
Sequence:CCGGCCTCGGTTCTGAGTCGTATAACTCGAGTTATACGACTCAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-3126s1c1
Sequence:CCGGCCCATGAACATCGACAGAAATCTCGAGATTTCTGTCGATGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024757.3-346s1c1
Sequence:CCGGGCAACGGATACATCTTAAATACTCGAGTATTTAAGATGTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-1346s21c1
Sequence:CCGGCCTCGGTTCTGAGTCGTATAACTCGAGTTATACGACTCAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024757.3-4777s21c1
Sequence:CCGGGTTAGTCTTGTAGCGTGAATACTCGAGTATTCACGCTACAAGACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-653s21c1
Sequence:GTACCGGTCGAGAAGCTAGAGATCATAACTCGAGTTATGATCTCTAGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-3499s21c1
Sequence:GTACCGGACCTCTTTGATCTCGACAATACTCGAGTATTGTCGAGATCAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024757.3-2864s21c1
Sequence:CCGGGGATTCAGATGTCACCTTAAACTCGAGTTTAAGGTGACATCTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172545
EHMT1 MISSION shRNA Bacterial Glycerol Stock
euchromatic histone-lysine N-methyltransferase 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172545.1-4567s1c1
Sequence:CCGGCGCTATGATGATGATGAATAACTCGAGTTATTCATCATCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-3317s1c1
Sequence:CCGGCCCTTGATCTTCGAGTGCAATCTCGAGATTGCACTCGAAGATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-1446s1c1
Sequence:CCGGGCGCTGGCTATATGGAAGTTTCTCGAGAAACTTCCATATAGCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-2459s1c1
Sequence:CCGGGCAGAGAACAACCACTTGGATCTCGAGATCCAAGTGGTTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-3293s1c1
Sequence:CCGGCCTGAGTTTAACATGGCAGAACTCGAGTTCTGCCATGTTAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-2541s21c1
Sequence:CCGGACTATGATGTGGTTCAGTATCCTCGAGGATACTGAACCACATCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1625s21c1
Sequence:CCGGGAGAGCGTGGATCACGAATTGCTCGAGCAATTCGTGATCCACGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-3488s21c1
Sequence:CCGGGTTCGGGAAGAGGACTCTTACCTCGAGGTAAGAGTCCTCTTCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-426s21c1
Sequence:CCGGCGTTGAGGACTCCCAACATTCCTCGAGGAATGTTGGGAGTCCTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1656s21c1
Sequence:CCGGCAAACAGCGTGGTCAAGTATGCTCGAGCATACTTGACCACGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-988s21c1
Sequence:CCGGTGATAGTGCCCTGCATGTAAACTCGAGTTTACATGCAGGGCACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1106s21c1
Sequence:CCGGGAGGATAGTAGGACTTCTAAACTCGAGTTTAGAAGTCCTACTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172545
EHMT1 MISSION shRNA shRNA Plasmid DNA
euchromatic histone-lysine N-methyltransferase 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172545.1-4567s1c1
Sequence:CCGGCGCTATGATGATGATGAATAACTCGAGTTATTCATCATCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-3317s1c1
Sequence:CCGGCCCTTGATCTTCGAGTGCAATCTCGAGATTGCACTCGAAGATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-1446s1c1
Sequence:CCGGGCGCTGGCTATATGGAAGTTTCTCGAGAAACTTCCATATAGCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-2459s1c1
Sequence:CCGGGCAGAGAACAACCACTTGGATCTCGAGATCCAAGTGGTTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-3293s1c1
Sequence:CCGGCCTGAGTTTAACATGGCAGAACTCGAGTTCTGCCATGTTAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-2541s21c1
Sequence:CCGGACTATGATGTGGTTCAGTATCCTCGAGGATACTGAACCACATCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1625s21c1
Sequence:CCGGGAGAGCGTGGATCACGAATTGCTCGAGCAATTCGTGATCCACGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-3488s21c1
Sequence:CCGGGTTCGGGAAGAGGACTCTTACCTCGAGGTAAGAGTCCTCTTCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-426s21c1
Sequence:CCGGCGTTGAGGACTCCCAACATTCCTCGAGGAATGTTGGGAGTCCTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1656s21c1
Sequence:CCGGCAAACAGCGTGGTCAAGTATGCTCGAGCATACTTGACCACGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-988s21c1
Sequence:CCGGTGATAGTGCCCTGCATGTAAACTCGAGTTTACATGCAGGGCACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1106s21c1
Sequence:CCGGGAGGATAGTAGGACTTCTAAACTCGAGTTTAGAAGTCCTACTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172545
EHMT1 MISSION shRNA Lentiviral Transduction Particles
euchromatic histone-lysine N-methyltransferase 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172545.1-4567s1c1
Sequence:CCGGCGCTATGATGATGATGAATAACTCGAGTTATTCATCATCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-3317s1c1
Sequence:CCGGCCCTTGATCTTCGAGTGCAATCTCGAGATTGCACTCGAAGATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-1446s1c1
Sequence:CCGGGCGCTGGCTATATGGAAGTTTCTCGAGAAACTTCCATATAGCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-2459s1c1
Sequence:CCGGGCAGAGAACAACCACTTGGATCTCGAGATCCAAGTGGTTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172545.1-3293s1c1
Sequence:CCGGCCTGAGTTTAACATGGCAGAACTCGAGTTCTGCCATGTTAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-2541s21c1
Sequence:CCGGACTATGATGTGGTTCAGTATCCTCGAGGATACTGAACCACATCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1625s21c1
Sequence:CCGGGAGAGCGTGGATCACGAATTGCTCGAGCAATTCGTGATCCACGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-3488s21c1
Sequence:CCGGGTTCGGGAAGAGGACTCTTACCTCGAGGTAAGAGTCCTCTTCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-426s21c1
Sequence:CCGGCGTTGAGGACTCCCAACATTCCTCGAGGAATGTTGGGAGTCCTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1656s21c1
Sequence:CCGGCAAACAGCGTGGTCAAGTATGCTCGAGCATACTTGACCACGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-988s21c1
Sequence:CCGGTGATAGTGCCCTGCATGTAAACTCGAGTTTACATGCAGGGCACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172545.3-1106s21c1
Sequence:CCGGGAGGATAGTAGGACTTCTAAACTCGAGTTTAGAAGTCCTACTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks