EMAIL THIS PAGE TO A FRIEND

EHMT2

euchromatic histone-lysine N-methyltransferase 2

82 Gene Product Result for
Synonyms: BAT8 C6orf30 G9A GAT8 KMT1C NG36
Gene ID:
Human(10919) Summary: A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. This gene is found near this cluster; it was mapped near the gene for C2 within a 120-kb region that included a HSP70 gene pair. These genes are all within the human major histocompatibility complex class III region. This gene was thought to be two different genes, NG36 and G9a, adjacent to each other but a recent publication shows that there is only a single gene. The protein encoded by this gene is thought to be involved in intracellular protein-protein interaction. There are three alternatively spliced transcript variants of this gene but only two are fully described. [provided by RefSeq, Jul 2008]
Mouse(110147) euchromatic histone lysine N-methyltransferase 2
Rat(361798) euchromatic histone lysine N-methyltransferase 2
Zebrafish(569250) euchromatic histone-lysine N-methyltransferase 2
domestic cat(101091940) euchromatic histone-lysine N-methyltransferase 2
cow(514062) euchromatic histone-lysine N-methyltransferase 2
Horse(100059118) euchromatic histone-lysine N-methyltransferase 2
dog(474851) euchromatic histone-lysine N-methyltransferase 2
naked mole-rat(101697232) euchromatic histone-lysine N-methyltransferase 2
domestic guinea pig(100728628) euchromatic histone-lysine N-methyltransferase 2
sheep(101115739) euchromatic histone-lysine N-methyltransferase 2
Domestic Rabbit(100355131) euchromatic histone-lysine N-methyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006709 Rosetta Predictions human pricing
NM_025256 Rosetta Predictions human pricing
NM_212463 Rosetta Predictions rat pricing
NM_145830 Rosetta Predictions mouse pricing
NM_147151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218409 predicted 437
2 SASI_Hs01_00218410 predicted 625
3 SASI_Hs01_00218411 predicted 3493
4 SASI_Hs01_00218412 predicted 450
5 SASI_Hs01_00218414 predicted 3089
6 SASI_Hs01_00218415 predicted 634
7 SASI_Hs01_00218416 predicted 3419
8 SASI_Hs01_00218418 predicted 3104
9 SASI_Hs02_00342133 predicted 1965
10 SASI_Hs02_00342134 predicted 452
11 SASI_Hs01_00218413 predicted 3228
12 SASI_Hs01_00218417 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075652 predicted 437
2 SASI_Hs01_00075653 predicted 626
3 SASI_Hs01_00075654 predicted 3395
4 SASI_Hs01_00075655 predicted 449
5 SASI_Hs01_00075657 predicted 2987
6 SASI_Hs01_00075658 predicted 636
7 SASI_Hs01_00075659 predicted 3316
8 SASI_Hs01_00075661 predicted 3010
9 SASI_Hs02_00358088 predicted 1864
10 SASI_Hs02_00358089 predicted 451
11 SASI_Hs01_00075656 predicted 3129
12 SASI_Hs01_00075660 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041924 predicted 3633
2 SASI_Rn01_00041925 predicted 467
3 SASI_Rn01_00041926 predicted 3446
4 SASI_Rn01_00041927 predicted 1528
5 SASI_Rn01_00041928 predicted 3259
6 SASI_Rn01_00041929 predicted 3229
7 SASI_Rn01_00041930 predicted 1481
8 SASI_Rn01_00041931 predicted 2938
9 SASI_Rn01_00041932 predicted 3472
10 SASI_Rn01_00041933 predicted 3403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136173 predicted 3644
2 SASI_Mm01_00136174 predicted 2364
3 SASI_Mm01_00136175 predicted 3627
4 SASI_Mm01_00136176 predicted 3605
5 SASI_Mm01_00136177 predicted 3447
6 SASI_Mm01_00136178 predicted 3400
7 SASI_Mm01_00136179 predicted 3398
8 SASI_Mm01_00136180 predicted 2321
9 SASI_Mm01_00136181 predicted 3470
10 SASI_Mm01_00136182 predicted 2840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162817 predicted 3368
2 SASI_Mm01_00162818 predicted 2092
3 SASI_Mm01_00162819 predicted 3356
4 SASI_Mm01_00162820 predicted 3329
5 SASI_Mm01_00162821 predicted 3175
6 SASI_Mm01_00162822 predicted 3128
7 SASI_Mm01_00162823 predicted 3129
8 SASI_Mm01_00162824 predicted 2046
9 SASI_Mm01_00162825 predicted 3199
10 SASI_Mm01_00162826 predicted 2562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025256
VALIDATED
EHMT2 MISSION shRNA Bacterial Glycerol Stock
euchromatic histone-lysine N-methyltransferase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025256.5-3090s21c1
Sequence:CCGGGGACCTTCATCTGCGAGTATGCTCGAGCATACTCGCAGATGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025256.5-2931s21c1
Sequence:CCGGAGATTGAGCCTCCGCTGATTTCTCGAGAAATCAGCGGAGGCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025256.4-3661s1c1
Sequence:CCGGCACACATTCCTGACCAGAGATCTCGAGATCTCTGGTCAGGAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025256.4-3163s1c1
Sequence:CCGGCCTCTTCGACTTAGACAACAACTCGAGTTGTTGTCTAAGTCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_025256.4-2915s1c1
Sequence:CCGGCTCCAGGAATTTAACAAGATTCTCGAGAATCTTGTTAAATTCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_025256.4-112s1c1
Sequence:CCGGCGAGAGAGTTCATGGCTCTTTCTCGAGAAAGAGCCATGAACTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025256.4-2914s1c1
Sequence:CCGGGCTCCAGGAATTTAACAAGATCTCGAGATCTTGTTAAATTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025256
VALIDATED
EHMT2 MISSION shRNA shRNA Plasmid DNA
euchromatic histone-lysine N-methyltransferase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025256.5-3090s21c1
Sequence:CCGGGGACCTTCATCTGCGAGTATGCTCGAGCATACTCGCAGATGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025256.5-2931s21c1
Sequence:CCGGAGATTGAGCCTCCGCTGATTTCTCGAGAAATCAGCGGAGGCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025256.4-3661s1c1
Sequence:CCGGCACACATTCCTGACCAGAGATCTCGAGATCTCTGGTCAGGAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025256.4-3163s1c1
Sequence:CCGGCCTCTTCGACTTAGACAACAACTCGAGTTGTTGTCTAAGTCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_025256.4-2915s1c1
Sequence:CCGGCTCCAGGAATTTAACAAGATTCTCGAGAATCTTGTTAAATTCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_025256.4-112s1c1
Sequence:CCGGCGAGAGAGTTCATGGCTCTTTCTCGAGAAAGAGCCATGAACTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025256.4-2914s1c1
Sequence:CCGGGCTCCAGGAATTTAACAAGATCTCGAGATCTTGTTAAATTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025256
VALIDATED
EHMT2 MISSION shRNA Lentiviral Transduction Particles
euchromatic histone-lysine N-methyltransferase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025256.5-3090s21c1
Sequence:CCGGGGACCTTCATCTGCGAGTATGCTCGAGCATACTCGCAGATGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025256.5-2931s21c1
Sequence:CCGGAGATTGAGCCTCCGCTGATTTCTCGAGAAATCAGCGGAGGCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025256.4-3661s1c1
Sequence:CCGGCACACATTCCTGACCAGAGATCTCGAGATCTCTGGTCAGGAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025256.4-3163s1c1
Sequence:CCGGCCTCTTCGACTTAGACAACAACTCGAGTTGTTGTCTAAGTCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_025256.4-2915s1c1
Sequence:CCGGCTCCAGGAATTTAACAAGATTCTCGAGAATCTTGTTAAATTCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_025256.4-112s1c1
Sequence:CCGGCGAGAGAGTTCATGGCTCTTTCTCGAGAAAGAGCCATGAACTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025256.4-2914s1c1
Sequence:CCGGGCTCCAGGAATTTAACAAGATCTCGAGATCTTGTTAAATTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145830
VALIDATED
EHMT2 MISSION shRNA Bacterial Glycerol Stock
euchromatic histone-lysine N-methyltransferase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-3414s21c1
Sequence:CCGGCCTCTTCGATTTAGATAACAACTCGAGTTGTTATCTAAATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-272s21c1
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-1029s21c1
Sequence:CCGGCGAAGCTCTAGCTGAACAGTTCTCGAGAACTGTTCAGCTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-3827s21c1
Sequence:CCGGAGACATTTCTCCATCAGAGACCTCGAGGTCTCTGATGGAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-2307s21c1
Sequence:CCGGGCAACAACGCACGCCACTAATCTCGAGATTAGTGGCGTGCGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145830.1-272s1c2
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-1183s1c1
Sequence:CCGGGCCAAGAAGAAATGGCGGAAACTCGAGTTTCCGCCATTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-2284s1c1
Sequence:CCGGGCCAACATCAATGCCGTAGATCTCGAGATCTACGGCATTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-272s1c1
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-3414s1c1
Sequence:CCGGCCTCTTCGATTTAGATAACAACTCGAGTTGTTATCTAAATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145830.1-1029s1c1
Sequence:CCGGCGAAGCTCTAGCTGAACAGTTCTCGAGAACTGTTCAGCTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145830
VALIDATED
EHMT2 MISSION shRNA shRNA Plasmid DNA
euchromatic histone-lysine N-methyltransferase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-3414s21c1
Sequence:CCGGCCTCTTCGATTTAGATAACAACTCGAGTTGTTATCTAAATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-272s21c1
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-1029s21c1
Sequence:CCGGCGAAGCTCTAGCTGAACAGTTCTCGAGAACTGTTCAGCTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-3827s21c1
Sequence:CCGGAGACATTTCTCCATCAGAGACCTCGAGGTCTCTGATGGAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-2307s21c1
Sequence:CCGGGCAACAACGCACGCCACTAATCTCGAGATTAGTGGCGTGCGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145830.1-272s1c2
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-1183s1c1
Sequence:CCGGGCCAAGAAGAAATGGCGGAAACTCGAGTTTCCGCCATTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-2284s1c1
Sequence:CCGGGCCAACATCAATGCCGTAGATCTCGAGATCTACGGCATTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-272s1c1
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-3414s1c1
Sequence:CCGGCCTCTTCGATTTAGATAACAACTCGAGTTGTTATCTAAATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145830.1-1029s1c1
Sequence:CCGGCGAAGCTCTAGCTGAACAGTTCTCGAGAACTGTTCAGCTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145830
VALIDATED
EHMT2 MISSION shRNA Lentiviral Transduction Particles
euchromatic histone-lysine N-methyltransferase 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-3414s21c1
Sequence:CCGGCCTCTTCGATTTAGATAACAACTCGAGTTGTTATCTAAATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-272s21c1
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-1029s21c1
Sequence:CCGGCGAAGCTCTAGCTGAACAGTTCTCGAGAACTGTTCAGCTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-3827s21c1
Sequence:CCGGAGACATTTCTCCATCAGAGACCTCGAGGTCTCTGATGGAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145830.1-2307s21c1
Sequence:CCGGGCAACAACGCACGCCACTAATCTCGAGATTAGTGGCGTGCGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145830.1-272s1c2
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-1183s1c1
Sequence:CCGGGCCAAGAAGAAATGGCGGAAACTCGAGTTTCCGCCATTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-2284s1c1
Sequence:CCGGGCCAACATCAATGCCGTAGATCTCGAGATCTACGGCATTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-272s1c1
Sequence:CCGGCCGAGAGAGTTCATAGCTCTTCTCGAGAAGAGCTATGAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145830.1-3414s1c1
Sequence:CCGGCCTCTTCGATTTAGATAACAACTCGAGTTGTTATCTAAATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145830.1-1029s1c1
Sequence:CCGGCGAAGCTCTAGCTGAACAGTTCTCGAGAACTGTTCAGCTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks