EMAIL THIS PAGE TO A FRIEND

EI24

etoposide induced 2.4

156 Gene Product Result for
Synonyms: EPG4 PIG8 TP53I8
UniProtKB ID: O14681, A8K7D6, Q9BUQ1
Gene ID:
Human(9538) Summary: This gene has higher expression in p53-expressing cells than in control cells and is an immediate-early induction target of p53-mediated apoptosis. The protein encoded by this gene contains six putative transmembrane domains and may suppress cell growth by inducing apoptotic cell death through the caspase 9 and mitochondrial pathways. This gene is located on human chromosome 11q24, a region frequently altered in cancers. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(13663) etoposide induced 2.4 mRNA
Rat(300514) etoposide induced 2.4
Zebrafish(550597) etoposide induced 2.4
chicken(419711) etoposide induced 2.4 mRNA
domestic cat(101082849) etoposide induced 2.4 mRNA
cow(532527) etoposide induced 2.4 mRNA
dog(489301) etoposide induced 2.4 mRNA
domestic guinea pig(100719887) etoposide induced 2.4
naked mole-rat(101699601) etoposide induced 2.4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004879 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007277 Rosetta Predictions human pricing
NM_004879 Rosetta Predictions human pricing
NM_001025660 Rosetta Predictions rat pricing
NM_007915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091615 predicted 539
2 SASI_Hs01_00091616 predicted 595
3 SASI_Hs01_00091617 predicted 666
4 SASI_Hs01_00091618 predicted 1424
5 SASI_Hs01_00091619 predicted 631
6 SASI_Hs01_00091620 predicted 468
7 SASI_Hs01_00091621 predicted 305
8 SASI_Hs01_00091622 predicted 590
9 SASI_Hs01_00091623 predicted 455
10 SASI_Hs01_00091624 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193135 predicted 546
2 SASI_Hs01_00193136 predicted 589
3 SASI_Hs01_00193137 predicted 665
4 SASI_Hs01_00193138 predicted 1536
5 SASI_Hs01_00193139 predicted 631
6 SASI_Hs01_00193140 predicted 463
7 SASI_Hs01_00193141 predicted 306
8 SASI_Hs01_00193142 predicted 592
9 SASI_Hs01_00193143 predicted 455
10 SASI_Hs01_00193144 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076682 predicted 380
2 SASI_Rn01_00076683 predicted 474
3 SASI_Rn01_00076684 predicted 504
4 SASI_Rn01_00076685 predicted 281
5 SASI_Rn01_00076686 predicted 661
6 SASI_Rn01_00076687 predicted 752
7 SASI_Rn01_00076688 predicted 802
8 SASI_Rn01_00076689 predicted 603
9 SASI_Rn01_00076690 predicted 342
10 SASI_Rn01_00076691 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199955 predicted 425
2 SASI_Mm01_00199956 predicted 837
3 SASI_Mm01_00199957 predicted 357
4 SASI_Mm02_00312725 predicted 481
5 SASI_Mm01_00199958 predicted 729
6 SASI_Mm01_00199959 predicted 1000
7 SASI_Mm02_00312726 predicted 639
8 SASI_Mm01_00199961 predicted 440
9 SASI_Mm02_00312727 predicted 312
10 SASI_Mm01_00199963 predicted 777
11 SASI_Mm01_00199960 predicted 308
12 SASI_Mm01_00199962 predicted 490
13 SASI_Mm01_00199964 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007915
VALIDATED
EI24 MISSION shRNA Bacterial Glycerol Stock
etoposide induced 2.4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-739s1c1
Sequence:CCGGAGCTGGTTAGTCTGCTGCATACTCGAGTATGCAGCAGACTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-794s1c1
Sequence:CCGGCCGTTGGTTCAACAAAGGAATCTCGAGATTCCTTTGTTGAACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-442s1c1
Sequence:CCGGCCCGGATTATTGGAGATCCATCTCGAGATGGATCTCCAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-1276s1c1
Sequence:CCGGCCCTTGTCTTTGAATTGGAATCTCGAGATTCCAATTCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-330s1c1
Sequence:CCGGCCACGTATTGTTAGTAGAATTCTCGAGAATTCTACTAACAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-326s21c1
Sequence:CCGGCCACGTATTGTTAGTAGAATTCTCGAGAATTCTACTAACAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-790s21c1
Sequence:CCGGCCGTTGGTTCAACAAAGGAATCTCGAGATTCCTTTGTTGAACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-735s21c1
Sequence:CCGGAGCTGGTTAGTCTGCTGCATACTCGAGTATGCAGCAGACTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007915.4-1272s21c1
Sequence:CCGGCCCTTGTCTTTGAATTGGAATCTCGAGATTCCAATTCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007915
VALIDATED
EI24 MISSION shRNA shRNA Plasmid DNA
etoposide induced 2.4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-739s1c1
Sequence:CCGGAGCTGGTTAGTCTGCTGCATACTCGAGTATGCAGCAGACTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-794s1c1
Sequence:CCGGCCGTTGGTTCAACAAAGGAATCTCGAGATTCCTTTGTTGAACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-442s1c1
Sequence:CCGGCCCGGATTATTGGAGATCCATCTCGAGATGGATCTCCAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-1276s1c1
Sequence:CCGGCCCTTGTCTTTGAATTGGAATCTCGAGATTCCAATTCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-330s1c1
Sequence:CCGGCCACGTATTGTTAGTAGAATTCTCGAGAATTCTACTAACAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-326s21c1
Sequence:CCGGCCACGTATTGTTAGTAGAATTCTCGAGAATTCTACTAACAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-790s21c1
Sequence:CCGGCCGTTGGTTCAACAAAGGAATCTCGAGATTCCTTTGTTGAACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-735s21c1
Sequence:CCGGAGCTGGTTAGTCTGCTGCATACTCGAGTATGCAGCAGACTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007915.4-1272s21c1
Sequence:CCGGCCCTTGTCTTTGAATTGGAATCTCGAGATTCCAATTCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007915
VALIDATED
EI24 MISSION shRNA Lentiviral Transduction Particles
etoposide induced 2.4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-739s1c1
Sequence:CCGGAGCTGGTTAGTCTGCTGCATACTCGAGTATGCAGCAGACTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-794s1c1
Sequence:CCGGCCGTTGGTTCAACAAAGGAATCTCGAGATTCCTTTGTTGAACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-442s1c1
Sequence:CCGGCCCGGATTATTGGAGATCCATCTCGAGATGGATCTCCAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-1276s1c1
Sequence:CCGGCCCTTGTCTTTGAATTGGAATCTCGAGATTCCAATTCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007915.1-330s1c1
Sequence:CCGGCCACGTATTGTTAGTAGAATTCTCGAGAATTCTACTAACAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-326s21c1
Sequence:CCGGCCACGTATTGTTAGTAGAATTCTCGAGAATTCTACTAACAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-790s21c1
Sequence:CCGGCCGTTGGTTCAACAAAGGAATCTCGAGATTCCTTTGTTGAACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007915.4-735s21c1
Sequence:CCGGAGCTGGTTAGTCTGCTGCATACTCGAGTATGCAGCAGACTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007915.4-1272s21c1
Sequence:CCGGCCCTTGTCTTTGAATTGGAATCTCGAGATTCCAATTCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004879
VALIDATED
EI24 MISSION shRNA Bacterial Glycerol Stock
etoposide induced 2.4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-301s1c1
Sequence:CCGGGAGCGGAAACAAGAGAGTGAACTCGAGTTCACTCTCTTGTTTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-556s1c1
Sequence:CCGGGCCATTTGGTTTCAGGATATACTCGAGTATATCCTGAAACCAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-400s1c1
Sequence:CCGGCGAGTATTTATTCCTGTGCTTCTCGAGAAGCACAGGAATAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-981s1c1
Sequence:CCGGCAAAGCATATCTCTTCCAGTTCTCGAGAACTGGAAGAGATATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-292s1c1
Sequence:CCGGCAGAGTATAGAGCGGAAACAACTCGAGTTGTTTCCGCTCTATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-643s1c1
Sequence:CCGGGCTGACATGCTCTTCAACCTTCTCGAGAAGGTTGAAGAGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-526s1c1
Sequence:CCGGCCCTTGTTTGTGCTTAGCAAACTCGAGTTTGCTAAGCACAAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-127s1c1
Sequence:CCGGGAGATGGCTGACAGTGTCAAACTCGAGTTTGACACTGTCAGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004879.3-1634s21c1
Sequence:CCGGGTAATTCTAGCTGTTGTATTTCTCGAGAAATACAACAGCTAGAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004879.3-952s21c1
Sequence:CCGGGGAATTGGCCTTACTACTTTGCTCGAGCAAAGTAGTAAGGCCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004879.3-423s21c1
Sequence:CCGGCAAGAGAGTGAGCCACGTATTCTCGAGAATACGTGGCTCACTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004879
VALIDATED
EI24 MISSION shRNA shRNA Plasmid DNA
etoposide induced 2.4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-301s1c1
Sequence:CCGGGAGCGGAAACAAGAGAGTGAACTCGAGTTCACTCTCTTGTTTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-556s1c1
Sequence:CCGGGCCATTTGGTTTCAGGATATACTCGAGTATATCCTGAAACCAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-400s1c1
Sequence:CCGGCGAGTATTTATTCCTGTGCTTCTCGAGAAGCACAGGAATAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-981s1c1
Sequence:CCGGCAAAGCATATCTCTTCCAGTTCTCGAGAACTGGAAGAGATATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-292s1c1
Sequence:CCGGCAGAGTATAGAGCGGAAACAACTCGAGTTGTTTCCGCTCTATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-643s1c1
Sequence:CCGGGCTGACATGCTCTTCAACCTTCTCGAGAAGGTTGAAGAGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-526s1c1
Sequence:CCGGCCCTTGTTTGTGCTTAGCAAACTCGAGTTTGCTAAGCACAAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-127s1c1
Sequence:CCGGGAGATGGCTGACAGTGTCAAACTCGAGTTTGACACTGTCAGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004879.3-1634s21c1
Sequence:CCGGGTAATTCTAGCTGTTGTATTTCTCGAGAAATACAACAGCTAGAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004879.3-952s21c1
Sequence:CCGGGGAATTGGCCTTACTACTTTGCTCGAGCAAAGTAGTAAGGCCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004879.3-423s21c1
Sequence:CCGGCAAGAGAGTGAGCCACGTATTCTCGAGAATACGTGGCTCACTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004879
VALIDATED
EI24 MISSION shRNA Lentiviral Transduction Particles
etoposide induced 2.4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-301s1c1
Sequence:CCGGGAGCGGAAACAAGAGAGTGAACTCGAGTTCACTCTCTTGTTTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-556s1c1
Sequence:CCGGGCCATTTGGTTTCAGGATATACTCGAGTATATCCTGAAACCAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-400s1c1
Sequence:CCGGCGAGTATTTATTCCTGTGCTTCTCGAGAAGCACAGGAATAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-981s1c1
Sequence:CCGGCAAAGCATATCTCTTCCAGTTCTCGAGAACTGGAAGAGATATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-292s1c1
Sequence:CCGGCAGAGTATAGAGCGGAAACAACTCGAGTTGTTTCCGCTCTATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-643s1c1
Sequence:CCGGGCTGACATGCTCTTCAACCTTCTCGAGAAGGTTGAAGAGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004879.2-526s1c1
Sequence:CCGGCCCTTGTTTGTGCTTAGCAAACTCGAGTTTGCTAAGCACAAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004879.2-127s1c1
Sequence:CCGGGAGATGGCTGACAGTGTCAAACTCGAGTTTGACACTGTCAGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004879.3-1634s21c1
Sequence:CCGGGTAATTCTAGCTGTTGTATTTCTCGAGAAATACAACAGCTAGAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004879.3-952s21c1
Sequence:CCGGGGAATTGGCCTTACTACTTTGCTCGAGCAAAGTAGTAAGGCCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004879.3-423s21c1
Sequence:CCGGCAAGAGAGTGAGCCACGTATTCTCGAGAATACGTGGCTCACTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks