EMAIL THIS PAGE TO A FRIEND

EID1

EP300 interacting inhibitor of differentiation 1

136 Gene Product Result for
Synonyms: C15orf3 CRI1 EID-1 IRO45620 PTD014 RBP21
UniProtKB ID: Q9Y6B2, B2RD11, Q8N7I4, Q9BZT9
Gene ID:
Mouse(58521) EP300 interacting inhibitor of differentiation 1
Rat(499882) EP300 interacting inhibitor of differentiation 1
Thale Cress(828008) phytochrome A-associated F-box protein EID1
domestic cat(101099302) EP300 interacting inhibitor of differentiation 1
cow(506056) EP300 interacting inhibitor of differentiation 1
dog(608367) EP300 interacting inhibitor of differentiation 1
naked mole-rat(101717455) EP300 interacting inhibitor of differentiation 1
domestic guinea pig(100718125) EP300 interacting inhibitor of differentiation 1
sheep(101110514) EP300 interacting inhibitor of differentiation 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014335 Rosetta Predictions human pricing
NM_001109205 Rosetta Predictions rat pricing
NM_025613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174593 predicted 445
2 SASI_Hs02_00345471 predicted 455
3 SASI_Hs01_00174592 predicted 1058
4 SASI_Hs01_00174595 predicted 611
5 SASI_Hs02_00345472 predicted 97
6 SASI_Hs01_00174598 predicted 644
7 SASI_Hs02_00345473 predicted 640
8 SASI_Hs02_00345474 predicted 511
9 SASI_Hs02_00345475 predicted 606
10 SASI_Hs02_00345476 predicted 624
11 SASI_Hs01_00174594 predicted 1034
12 SASI_Hs01_00174596 predicted 1000
13 SASI_Hs01_00174597 predicted 687
14 SASI_Hs01_00174599 predicted 708
15 SASI_Hs01_00174600 predicted 1146
16 SASI_Hs01_00174601 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246130 predicted 617
2 SASI_Rn02_00246131 predicted 475
3 SASI_Rn02_00246132 predicted 595
4 SASI_Rn02_00246133 predicted 610
5 SASI_Rn02_00246134 predicted 473
6 SASI_Rn02_00246135 predicted 297
7 SASI_Rn02_00246136 predicted 534
8 SASI_Rn02_00246137 predicted 479
9 SASI_Rn02_00246138 predicted 464
10 SASI_Rn02_00246139 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037752 predicted 603
2 SASI_Mm02_00328648 predicted 523
3 SASI_Mm02_00328649 predicted 549
4 SASI_Mm02_00328650 predicted 596
5 SASI_Mm01_00037758 predicted 467
6 SASI_Mm01_00037755 predicted 468
7 SASI_Mm02_00328651 predicted 1057
8 SASI_Mm02_00328652 predicted 915
9 SASI_Mm02_00328653 predicted 1070
10 SASI_Mm02_00328654 predicted 903
11 SASI_Mm01_00037753 predicted 473
12 SASI_Mm01_00037754 predicted 610
13 SASI_Mm01_00037756 predicted 740
14 SASI_Mm01_00037757 predicted 556
15 SASI_Mm01_00037759 predicted 533
16 SASI_Mm01_00037760 predicted 543
17 SASI_Mm01_00037761 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014335
VALIDATED
EID1 MISSION shRNA Bacterial Glycerol Stock
EP300 interacting inhibitor of differentiation 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-483s21c1
Sequence:CCGGGATGTTTCTGAGAACAAGAGACTCGAGTCTCTTGTTCTCAGAAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014335.2-891s21c1
Sequence:CCGGCCTATGGCTTTGACTTTGTTACTCGAGTAACAAAGTCAAAGCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-469s21c1
Sequence:CCGGGAAGAAGCCGACAAGATGTTTCTCGAGAAACATCTTGTCGGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-616s21c1
Sequence:CCGGCTCGGCTGTGATGAGATTATTCTCGAGAATAATCTCATCACAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014335.2-475s1c1
Sequence:CCGGGCCGACAAGATGTTTCTGAGACTCGAGTCTCAGAAACATCTTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-891s1c1
Sequence:CCGGCCTATGGCTTTGACTTTGTTACTCGAGTAACAAAGTCAAAGCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-1927s1c1
Sequence:CCGGCCTTACTAAGATGCTGAAGTTCTCGAGAACTTCAGCATCTTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-483s1c1
Sequence:CCGGGATGTTTCTGAGAACAAGAGACTCGAGTCTCTTGTTCTCAGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014335.2-616s1c1
Sequence:CCGGCTCGGCTGTGATGAGATTATTCTCGAGAATAATCTCATCACAGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-613s1c1
Sequence:CCGGGAACTCGGCTGTGATGAGATTCTCGAGAATCTCATCACAGCCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-381s1c1
Sequence:CCGGCGAGGAATTTGATGACTGGGACTCGAGTCCCAGTCATCAAATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014335.2-111s1c1
Sequence:CCGGGCTGTATGAAGAGAGCAGTGACTCGAGTCACTGCTCTCTTCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014335.2-469s1c1
Sequence:CCGGGAAGAAGCCGACAAGATGTTTCTCGAGAAACATCTTGTCGGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-1939s1c1
Sequence:CCGGGCTGAAGTTCTAGGAGAGTAACTCGAGTTACTCTCCTAGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014335
VALIDATED
EID1 MISSION shRNA shRNA Plasmid DNA
EP300 interacting inhibitor of differentiation 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-483s21c1
Sequence:CCGGGATGTTTCTGAGAACAAGAGACTCGAGTCTCTTGTTCTCAGAAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014335.2-891s21c1
Sequence:CCGGCCTATGGCTTTGACTTTGTTACTCGAGTAACAAAGTCAAAGCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-469s21c1
Sequence:CCGGGAAGAAGCCGACAAGATGTTTCTCGAGAAACATCTTGTCGGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-616s21c1
Sequence:CCGGCTCGGCTGTGATGAGATTATTCTCGAGAATAATCTCATCACAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014335.2-475s1c1
Sequence:CCGGGCCGACAAGATGTTTCTGAGACTCGAGTCTCAGAAACATCTTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-891s1c1
Sequence:CCGGCCTATGGCTTTGACTTTGTTACTCGAGTAACAAAGTCAAAGCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-1927s1c1
Sequence:CCGGCCTTACTAAGATGCTGAAGTTCTCGAGAACTTCAGCATCTTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-483s1c1
Sequence:CCGGGATGTTTCTGAGAACAAGAGACTCGAGTCTCTTGTTCTCAGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014335.2-616s1c1
Sequence:CCGGCTCGGCTGTGATGAGATTATTCTCGAGAATAATCTCATCACAGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-613s1c1
Sequence:CCGGGAACTCGGCTGTGATGAGATTCTCGAGAATCTCATCACAGCCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-381s1c1
Sequence:CCGGCGAGGAATTTGATGACTGGGACTCGAGTCCCAGTCATCAAATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014335.2-111s1c1
Sequence:CCGGGCTGTATGAAGAGAGCAGTGACTCGAGTCACTGCTCTCTTCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014335.2-469s1c1
Sequence:CCGGGAAGAAGCCGACAAGATGTTTCTCGAGAAACATCTTGTCGGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-1939s1c1
Sequence:CCGGGCTGAAGTTCTAGGAGAGTAACTCGAGTTACTCTCCTAGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014335
VALIDATED
EID1 MISSION shRNA Lentiviral Transduction Particles
EP300 interacting inhibitor of differentiation 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-483s21c1
Sequence:CCGGGATGTTTCTGAGAACAAGAGACTCGAGTCTCTTGTTCTCAGAAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014335.2-891s21c1
Sequence:CCGGCCTATGGCTTTGACTTTGTTACTCGAGTAACAAAGTCAAAGCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-469s21c1
Sequence:CCGGGAAGAAGCCGACAAGATGTTTCTCGAGAAACATCTTGTCGGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014335.2-616s21c1
Sequence:CCGGCTCGGCTGTGATGAGATTATTCTCGAGAATAATCTCATCACAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014335.2-475s1c1
Sequence:CCGGGCCGACAAGATGTTTCTGAGACTCGAGTCTCAGAAACATCTTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-891s1c1
Sequence:CCGGCCTATGGCTTTGACTTTGTTACTCGAGTAACAAAGTCAAAGCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-1927s1c1
Sequence:CCGGCCTTACTAAGATGCTGAAGTTCTCGAGAACTTCAGCATCTTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-483s1c1
Sequence:CCGGGATGTTTCTGAGAACAAGAGACTCGAGTCTCTTGTTCTCAGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014335.2-616s1c1
Sequence:CCGGCTCGGCTGTGATGAGATTATTCTCGAGAATAATCTCATCACAGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-613s1c1
Sequence:CCGGGAACTCGGCTGTGATGAGATTCTCGAGAATCTCATCACAGCCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014335.2-381s1c1
Sequence:CCGGCGAGGAATTTGATGACTGGGACTCGAGTCCCAGTCATCAAATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014335.2-111s1c1
Sequence:CCGGGCTGTATGAAGAGAGCAGTGACTCGAGTCACTGCTCTCTTCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014335.2-469s1c1
Sequence:CCGGGAAGAAGCCGACAAGATGTTTCTCGAGAAACATCTTGTCGGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014335.2-1939s1c1
Sequence:CCGGGCTGAAGTTCTAGGAGAGTAACTCGAGTTACTCTCCTAGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025613
EID1 MISSION shRNA Bacterial Glycerol Stock
EP300 interacting inhibitor of differentiation 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-545s1c1
Sequence:CCGGGCTCGGTTGTGATGAGATCATCTCGAGATGATCTCATCACAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-560s1c1
Sequence:CCGGGATCATTGATCGAGAGTTAATCTCGAGATTAACTCTCGATCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-128s1c1
Sequence:CCGGGTACGAAGAAAGCAACGAGTTCTCGAGAACTCGTTGCTTTCTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-558s1c1
Sequence:CCGGGAGATCATTGATCGAGAGTTACTCGAGTAACTCTCGATCAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025613.1-1102s1c1
Sequence:CCGGCCCACAGAGTAGTCCAAGTAACTCGAGTTACTTGGACTACTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025613
EID1 MISSION shRNA shRNA Plasmid DNA
EP300 interacting inhibitor of differentiation 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-545s1c1
Sequence:CCGGGCTCGGTTGTGATGAGATCATCTCGAGATGATCTCATCACAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-560s1c1
Sequence:CCGGGATCATTGATCGAGAGTTAATCTCGAGATTAACTCTCGATCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-128s1c1
Sequence:CCGGGTACGAAGAAAGCAACGAGTTCTCGAGAACTCGTTGCTTTCTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-558s1c1
Sequence:CCGGGAGATCATTGATCGAGAGTTACTCGAGTAACTCTCGATCAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025613.1-1102s1c1
Sequence:CCGGCCCACAGAGTAGTCCAAGTAACTCGAGTTACTTGGACTACTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025613
EID1 MISSION shRNA Lentiviral Transduction Particles
EP300 interacting inhibitor of differentiation 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-545s1c1
Sequence:CCGGGCTCGGTTGTGATGAGATCATCTCGAGATGATCTCATCACAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-560s1c1
Sequence:CCGGGATCATTGATCGAGAGTTAATCTCGAGATTAACTCTCGATCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-128s1c1
Sequence:CCGGGTACGAAGAAAGCAACGAGTTCTCGAGAACTCGTTGCTTTCTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025613.1-558s1c1
Sequence:CCGGGAGATCATTGATCGAGAGTTACTCGAGTAACTCTCGATCAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025613.1-1102s1c1
Sequence:CCGGCCCACAGAGTAGTCCAAGTAACTCGAGTTACTTGGACTACTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks