EMAIL THIS PAGE TO A FRIEND

EID2

EP300 interacting inhibitor of differentiation 2

45 Gene Product Result for
Synonyms: CRI2 EID-2
UniProtKB ID: Q8N6I1, A7YQ71, Q6X7T0, Q6ZR61
Gene ID:
Mouse(386655) EP300 interacting inhibitor of differentiation 2
Rat(685691) EP300 interacting inhibitor of differentiation 2
sheep(101116852) EP300 interacting inhibitor of differentiation 2
domestic guinea pig(100714658) EP300 interacting inhibitor of differentiation 2
naked mole-rat(101724494) EP300 interacting inhibitor of differentiation 2
dog(612523) EP300-interacting inhibitor of differentiation 2-like
cow(615269) EP300 interacting inhibitor of differentiation 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153232 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153232 Rosetta Predictions human pricing
XM_001064863 Rosetta Predictions rat pricing
NM_198425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367095 predicted 862
2 SASI_Hs01_00127989 predicted 684
3 SASI_Hs01_00127990 predicted 1030
4 SASI_Hs01_00127992 predicted 1006
5 SASI_Hs02_00367096 predicted 709
6 SASI_Hs01_00127993 predicted 1013
7 SASI_Hs01_00127994 predicted 788
8 SASI_Hs01_00127995 predicted 876
9 SASI_Hs01_00127996 predicted 829
10 SASI_Hs02_00367097 predicted 865
11 SASI_Hs01_00127987 predicted 805
12 SASI_Hs01_00127988 predicted 695
13 SASI_Hs01_00127991 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312018 predicted 243
2 SASI_Rn02_00312019 predicted 238
3 SASI_Rn02_00312020 predicted 235
4 SASI_Rn02_00312021 predicted 279
5 SASI_Rn02_00312022 predicted 321
6 SASI_Rn02_00312023 predicted 234
7 SASI_Rn02_00312024 predicted 222
8 SASI_Rn02_00312025 predicted 1489
9 SASI_Rn02_00312026 predicted 1478
10 SASI_Rn02_00312027 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180955 predicted 958
2 SASI_Mm01_00180956 predicted 752
3 SASI_Mm01_00180957 predicted 711
4 SASI_Mm01_00180958 predicted 637
5 SASI_Mm01_00180959 predicted 802
6 SASI_Mm01_00180960 predicted 810
7 SASI_Mm01_00180961 predicted 941
8 SASI_Mm01_00180962 predicted 718
9 SASI_Mm01_00180963 predicted 723
10 SASI_Mm01_00180964 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198425
EID2 MISSION shRNA Bacterial Glycerol Stock
EP300 interacting inhibitor of differentiation 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198425.2-953s1c1
Sequence:CCGGCCTACCGTTTCTTGAGTTTATCTCGAGATAAACTCAAGAAACGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-729s1c1
Sequence:CCGGGTGATCAATCCTCTAATAGAACTCGAGTTCTATTAGAGGATTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-734s1c1
Sequence:CCGGCAATCCTCTAATAGAAGAACTCTCGAGAGTTCTTCTATTAGAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198425.2-1125s1c1
Sequence:CCGGCGAGGTTTCTGTGGAGAACTTCTCGAGAAGTTCTCCACAGAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-524s1c1
Sequence:CCGGCATCAATTACCAGCAGTTCCTCTCGAGAGGAACTGCTGGTAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198425.2-726s1c1
Sequence:CCGGGAGGTGATCAATCCTCTAATACTCGAGTATTAGAGGATTGATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193686    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198425.2-1015s1c1
Sequence:CCGGCGTGGCTTCGTTAATAAGTAACTCGAGTTACTTATTAACGAAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198425
EID2 MISSION shRNA shRNA Plasmid DNA
EP300 interacting inhibitor of differentiation 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198425.2-953s1c1
Sequence:CCGGCCTACCGTTTCTTGAGTTTATCTCGAGATAAACTCAAGAAACGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-729s1c1
Sequence:CCGGGTGATCAATCCTCTAATAGAACTCGAGTTCTATTAGAGGATTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-734s1c1
Sequence:CCGGCAATCCTCTAATAGAAGAACTCTCGAGAGTTCTTCTATTAGAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198425.2-1125s1c1
Sequence:CCGGCGAGGTTTCTGTGGAGAACTTCTCGAGAAGTTCTCCACAGAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-524s1c1
Sequence:CCGGCATCAATTACCAGCAGTTCCTCTCGAGAGGAACTGCTGGTAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198425.2-726s1c1
Sequence:CCGGGAGGTGATCAATCCTCTAATACTCGAGTATTAGAGGATTGATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193686    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198425.2-1015s1c1
Sequence:CCGGCGTGGCTTCGTTAATAAGTAACTCGAGTTACTTATTAACGAAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198425
EID2 MISSION shRNA Lentiviral Transduction Particles
EP300 interacting inhibitor of differentiation 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198425.2-953s1c1
Sequence:CCGGCCTACCGTTTCTTGAGTTTATCTCGAGATAAACTCAAGAAACGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-729s1c1
Sequence:CCGGGTGATCAATCCTCTAATAGAACTCGAGTTCTATTAGAGGATTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-734s1c1
Sequence:CCGGCAATCCTCTAATAGAAGAACTCTCGAGAGTTCTTCTATTAGAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198425.2-1125s1c1
Sequence:CCGGCGAGGTTTCTGTGGAGAACTTCTCGAGAAGTTCTCCACAGAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198425.2-524s1c1
Sequence:CCGGCATCAATTACCAGCAGTTCCTCTCGAGAGGAACTGCTGGTAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198425.2-726s1c1
Sequence:CCGGGAGGTGATCAATCCTCTAATACTCGAGTATTAGAGGATTGATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193686    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198425.2-1015s1c1
Sequence:CCGGCGTGGCTTCGTTAATAAGTAACTCGAGTTACTTATTAACGAAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153232
EID2 MISSION shRNA Bacterial Glycerol Stock
EP300 interacting inhibitor of differentiation 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153232.3-1208s1c1
Sequence:CCGGGCTGAGTTATTAGGACTGGAACTCGAGTTCCAGTCCTAATAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-621s1c1
Sequence:CCGGCCCGGCAGAATACAAGAGCTTCTCGAGAAGCTCTTGTATTCTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-566s1c1
Sequence:CCGGAGGCATCAATTACCAGCAGTTCTCGAGAACTGCTGGTAATTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-771s1c1
Sequence:CCGGGAAGTTATCAACCCTCTGATACTCGAGTATCAGAGGGTTGATAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-687s1c1
Sequence:CCGGGCAGCGTTTGATGCCGAATATCTCGAGATATTCGGCATCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153232.3-721s21c1
Sequence:CCGGACAGGGTGGACCTCGATATTTCTCGAGAAATATCGAGGTCCACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153232.3-1240s21c1
Sequence:CCGGGAACTTGAAATTGTCGGAATACTCGAGTATTCCGACAATTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153232.3-1013s21c1
Sequence:CCGGTTATAACTGTAACGTTCTTTGCTCGAGCAAAGAACGTTACAGTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153232.3-802s21c1
Sequence:CCGGGTTGCGATAAGTTTATCAATACTCGAGTATTGATAAACTTATCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153232
EID2 MISSION shRNA shRNA Plasmid DNA
EP300 interacting inhibitor of differentiation 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153232.3-1208s1c1
Sequence:CCGGGCTGAGTTATTAGGACTGGAACTCGAGTTCCAGTCCTAATAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-621s1c1
Sequence:CCGGCCCGGCAGAATACAAGAGCTTCTCGAGAAGCTCTTGTATTCTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-566s1c1
Sequence:CCGGAGGCATCAATTACCAGCAGTTCTCGAGAACTGCTGGTAATTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-771s1c1
Sequence:CCGGGAAGTTATCAACCCTCTGATACTCGAGTATCAGAGGGTTGATAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-687s1c1
Sequence:CCGGGCAGCGTTTGATGCCGAATATCTCGAGATATTCGGCATCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153232.3-721s21c1
Sequence:CCGGACAGGGTGGACCTCGATATTTCTCGAGAAATATCGAGGTCCACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153232.3-1240s21c1
Sequence:CCGGGAACTTGAAATTGTCGGAATACTCGAGTATTCCGACAATTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153232.3-1013s21c1
Sequence:CCGGTTATAACTGTAACGTTCTTTGCTCGAGCAAAGAACGTTACAGTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153232.3-802s21c1
Sequence:CCGGGTTGCGATAAGTTTATCAATACTCGAGTATTGATAAACTTATCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153232
EID2 MISSION shRNA Lentiviral Transduction Particles
EP300 interacting inhibitor of differentiation 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153232.3-1208s1c1
Sequence:CCGGGCTGAGTTATTAGGACTGGAACTCGAGTTCCAGTCCTAATAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-621s1c1
Sequence:CCGGCCCGGCAGAATACAAGAGCTTCTCGAGAAGCTCTTGTATTCTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-566s1c1
Sequence:CCGGAGGCATCAATTACCAGCAGTTCTCGAGAACTGCTGGTAATTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-771s1c1
Sequence:CCGGGAAGTTATCAACCCTCTGATACTCGAGTATCAGAGGGTTGATAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153232.3-687s1c1
Sequence:CCGGGCAGCGTTTGATGCCGAATATCTCGAGATATTCGGCATCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153232.3-721s21c1
Sequence:CCGGACAGGGTGGACCTCGATATTTCTCGAGAAATATCGAGGTCCACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153232.3-1240s21c1
Sequence:CCGGGAACTTGAAATTGTCGGAATACTCGAGTATTCCGACAATTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153232.3-1013s21c1
Sequence:CCGGTTATAACTGTAACGTTCTTTGCTCGAGCAAAGAACGTTACAGTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153232.3-802s21c1
Sequence:CCGGGTTGCGATAAGTTTATCAATACTCGAGTATTGATAAACTTATCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks