EMAIL THIS PAGE TO A FRIEND

EID2B

EP300 interacting inhibitor of differentiation 2B

63 Gene Product Result for
Synonyms: EID-3
UniProtKB ID: Q96D98, Q8N8S0
Gene ID:
Mouse(434156) EP300 interacting inhibitor of differentiation 2B
Rat(499112) EP300 interacting inhibitor of differentiation 2B
naked mole-rat(101724842) EP300 interacting inhibitor of differentiation 2B
domestic guinea pig(100733956) EP300 interacting inhibitor of differentiation 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152361 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU170931 MISSION® esiRNA esiRNA targeting mouse Eid2b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152361 Rosetta Predictions human pricing
XM_574407 Rosetta Predictions rat pricing
XR_009205 Rosetta Predictions rat pricing
XM_908198 Rosetta Predictions mouse pricing
XM_994514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366004 predicted 291
2 SASI_Hs01_00190447 predicted 357
3 SASI_Hs01_00190449 predicted 294
4 SASI_Hs02_00366005 predicted 322
5 SASI_Hs01_00190450 predicted 336
6 SASI_Hs01_00190451 predicted 365
7 SASI_Hs01_00190453 predicted 471
8 SASI_Hs01_00190454 predicted 343
9 SASI_Hs01_00190455 predicted 480
10 SASI_Hs01_00190456 predicted 501
11 SASI_Hs01_00190448 predicted 334
12 SASI_Hs01_00190452 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401960 predicted 199
2 SASI_Rn02_00401961 predicted 262
3 SASI_Rn02_00401962 predicted 334
4 SASI_Rn02_00401963 predicted 464
5 SASI_Rn02_00401964 predicted 237
6 SASI_Rn02_00401965 predicted 300
7 SASI_Rn02_00401966 predicted 244
8 SASI_Rn02_00401967 predicted 419
9 SASI_Rn02_00401968 predicted 237
10 SASI_Rn02_00401969 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167186 predicted 200
2 SASI_Rn01_00167187 predicted 257
3 SASI_Rn02_00419085 predicted 342
4 SASI_Rn01_00167188 predicted 462
5 SASI_Rn01_00167190 predicted 236
6 SASI_Rn01_00167191 predicted 299
7 SASI_Rn01_00167192 predicted 246
8 SASI_Rn01_00167193 predicted 413
9 SASI_Rn02_00419086 predicted 237
10 SASI_Rn01_00167194 predicted 260
11 SASI_Rn01_00167189 predicted 334
12 SASI_Rn01_00167195 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433847 predicted 76
2 SASI_Mm02_00433848 predicted 1241
3 SASI_Mm02_00433849 predicted 498
4 SASI_Mm02_00433850 predicted 918
5 SASI_Mm02_00433851 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451792 predicted 70
2 SASI_Mm01_00245292 predicted 1243
3 SASI_Mm01_00245297 predicted 492
4 SASI_Mm02_00451793 predicted 913
5 SASI_Mm02_00451794 predicted 709
6 SASI_Mm01_00245293 predicted 355
7 SASI_Mm01_00245294 predicted 464
8 SASI_Mm01_00245295 predicted 466
9 SASI_Mm01_00245296 predicted 395
10 SASI_Mm01_00245298 predicted 376
11 SASI_Mm01_00245299 predicted 436
12 SASI_Mm01_00245300 predicted 1015
13 SASI_Mm01_00245301 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152361
EID2B MISSION shRNA Bacterial Glycerol Stock
EP300 interacting inhibitor of differentiation 2B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-1118s1c1
Sequence:CCGGGAAGGCTATTGAGAGGACTTTCTCGAGAAAGTCCTCTCAATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152361.1-313s1c1
Sequence:CCGGCTTAGAAATTAACCGGCAGCTCTCGAGAGCTGCCGGTTAATTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152361.1-296s1c1
Sequence:CCGGCATCAGCAGCTCGCTTTCTTACTCGAGTAAGAAAGCGAGCTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152361.1-835s1c1
Sequence:CCGGCCCAAAGTGCTGGGATTACTTCTCGAGAAGTAATCCCAGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152361.1-1091s1c1
Sequence:CCGGCCAGGTGTACCTGAGTTACTACTCGAGTAGTAACTCAGGTACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-644s1c1
Sequence:CCGGGAATGCAAACTGGAAGGGAATCTCGAGATTCCCTTCCAGTTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-924s1c1
Sequence:CCGGGCACTTTGTTAGCAATGCATTCTCGAGAATGCATTGCTAACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152361.1-308s1c1
Sequence:CCGGGCTTTCTTAGAAATTAACCGGCTCGAGCCGGTTAATTTCTAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-1022s1c1
Sequence:CCGGCCAATAACAGAACCCATAGAACTCGAGTTCTATGGGTTCTGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152361
EID2B MISSION shRNA shRNA Plasmid DNA
EP300 interacting inhibitor of differentiation 2B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-1118s1c1
Sequence:CCGGGAAGGCTATTGAGAGGACTTTCTCGAGAAAGTCCTCTCAATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152361.1-313s1c1
Sequence:CCGGCTTAGAAATTAACCGGCAGCTCTCGAGAGCTGCCGGTTAATTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152361.1-296s1c1
Sequence:CCGGCATCAGCAGCTCGCTTTCTTACTCGAGTAAGAAAGCGAGCTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152361.1-835s1c1
Sequence:CCGGCCCAAAGTGCTGGGATTACTTCTCGAGAAGTAATCCCAGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152361.1-1091s1c1
Sequence:CCGGCCAGGTGTACCTGAGTTACTACTCGAGTAGTAACTCAGGTACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-644s1c1
Sequence:CCGGGAATGCAAACTGGAAGGGAATCTCGAGATTCCCTTCCAGTTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-924s1c1
Sequence:CCGGGCACTTTGTTAGCAATGCATTCTCGAGAATGCATTGCTAACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152361.1-308s1c1
Sequence:CCGGGCTTTCTTAGAAATTAACCGGCTCGAGCCGGTTAATTTCTAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-1022s1c1
Sequence:CCGGCCAATAACAGAACCCATAGAACTCGAGTTCTATGGGTTCTGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152361
EID2B MISSION shRNA Lentiviral Transduction Particles
EP300 interacting inhibitor of differentiation 2B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-1118s1c1
Sequence:CCGGGAAGGCTATTGAGAGGACTTTCTCGAGAAAGTCCTCTCAATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152361.1-313s1c1
Sequence:CCGGCTTAGAAATTAACCGGCAGCTCTCGAGAGCTGCCGGTTAATTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152361.1-296s1c1
Sequence:CCGGCATCAGCAGCTCGCTTTCTTACTCGAGTAAGAAAGCGAGCTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152361.1-835s1c1
Sequence:CCGGCCCAAAGTGCTGGGATTACTTCTCGAGAAGTAATCCCAGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152361.1-1091s1c1
Sequence:CCGGCCAGGTGTACCTGAGTTACTACTCGAGTAGTAACTCAGGTACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-644s1c1
Sequence:CCGGGAATGCAAACTGGAAGGGAATCTCGAGATTCCCTTCCAGTTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-924s1c1
Sequence:CCGGGCACTTTGTTAGCAATGCATTCTCGAGAATGCATTGCTAACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152361.1-308s1c1
Sequence:CCGGGCTTTCTTAGAAATTAACCGGCTCGAGCCGGTTAATTTCTAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152361.1-1022s1c1
Sequence:CCGGCCAATAACAGAACCCATAGAACTCGAGTTCTATGGGTTCTGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks