EMAIL THIS PAGE TO A FRIEND

EID3

EP300 interacting inhibitor of differentiation 3

43 Gene Product Result for
Synonyms: NS4EB NSE4B NSMCE4B
UniProtKB ID: Q8N140
Gene ID:
Mouse(66341) EP300 interacting inhibitor of differentiation 3
Rat(691688) EP300 interacting inhibitor of differentiation 3
sheep(101113401) EP300 interacting inhibitor of differentiation 3
naked mole-rat(101700021) EP300 interacting inhibitor of differentiation 3
dog(100687031) EP300 interacting inhibitor of differentiation 3
cow(507232) EP300 interacting inhibitor of differentiation 3
domestic cat(101085479) EP300 interacting inhibitor of differentiation 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008394 Rosetta Predictions human pricing
NM_001044304 Rosetta Predictions rat pricing
NM_025499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243385 predicted 571
2 SASI_Hs01_00243386 predicted 582
3 SASI_Hs01_00243387 predicted 330
4 SASI_Hs01_00243388 predicted 633
5 SASI_Hs01_00243389 predicted 580
6 SASI_Hs01_00243390 predicted 432
7 SASI_Hs01_00243391 predicted 471
8 SASI_Hs02_00305428 predicted 560
9 SASI_Hs01_00243393 predicted 899
10 SASI_Hs01_00243394 predicted 492
11 SASI_Hs01_00243392 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205704 predicted 710
2 SASI_Rn02_00205705 predicted 645
3 SASI_Rn02_00205706 predicted 531
4 SASI_Rn02_00205707 predicted 708
5 SASI_Rn02_00205708 predicted 575
6 SASI_Rn02_00205709 predicted 776
7 SASI_Rn02_00205710 predicted 532
8 SASI_Rn02_00205711 predicted 843
9 SASI_Rn02_00205712 predicted 600
10 SASI_Rn02_00205713 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085601 predicted 591
2 SASI_Mm02_00328380 predicted 965
3 SASI_Mm01_00085602 predicted 701
4 SASI_Mm01_00085603 predicted 918
5 SASI_Mm01_00085604 predicted 563
6 SASI_Mm01_00085605 predicted 520
7 SASI_Mm01_00085606 predicted 801
8 SASI_Mm01_00085607 predicted 602
9 SASI_Mm01_00085608 predicted 798
10 SASI_Mm01_00085609 predicted 827
11 SASI_Mm01_00085610 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025499
EID3 MISSION shRNA Bacterial Glycerol Stock
EP300 interacting inhibitor of differentiation 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-769s1c1
Sequence:CCGGGAAGTGGAGATATGCCTACAACTCGAGTTGTAGGCATATCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-609s1c1
Sequence:CCGGGATAGCATAGTTCTTTCCTTTCTCGAGAAAGGAAAGAACTATGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-899s1c1
Sequence:CCGGGTCATACTTTGAGTTTGTGATCTCGAGATCACAAACTCAAAGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-1111s21c1
Sequence:CCGGTGCAGGAAACAAGGCGTTATACTCGAGTATAACGCCTTGTTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-624s21c1
Sequence:CCGGATTTAGCGACTGCGATGATAGCTCGAGCTATCATCGCAGTCGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-920s21c1
Sequence:CCGGATACTCCAGTGTCATACTTTGCTCGAGCAAAGTATGACACTGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-556s21c1
Sequence:CCGGCCCATTGCCTTCTGCGATTTGCTCGAGCAAATCGCAGAAGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-704s21c1
Sequence:CCGGCCGAAACGTTCCACTTCATTTCTCGAGAAATGAAGTGGAACGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025499
EID3 MISSION shRNA shRNA Plasmid DNA
EP300 interacting inhibitor of differentiation 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-769s1c1
Sequence:CCGGGAAGTGGAGATATGCCTACAACTCGAGTTGTAGGCATATCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-609s1c1
Sequence:CCGGGATAGCATAGTTCTTTCCTTTCTCGAGAAAGGAAAGAACTATGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-899s1c1
Sequence:CCGGGTCATACTTTGAGTTTGTGATCTCGAGATCACAAACTCAAAGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-1111s21c1
Sequence:CCGGTGCAGGAAACAAGGCGTTATACTCGAGTATAACGCCTTGTTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-624s21c1
Sequence:CCGGATTTAGCGACTGCGATGATAGCTCGAGCTATCATCGCAGTCGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-920s21c1
Sequence:CCGGATACTCCAGTGTCATACTTTGCTCGAGCAAAGTATGACACTGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-556s21c1
Sequence:CCGGCCCATTGCCTTCTGCGATTTGCTCGAGCAAATCGCAGAAGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-704s21c1
Sequence:CCGGCCGAAACGTTCCACTTCATTTCTCGAGAAATGAAGTGGAACGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025499
EID3 MISSION shRNA Lentiviral Transduction Particles
EP300 interacting inhibitor of differentiation 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-769s1c1
Sequence:CCGGGAAGTGGAGATATGCCTACAACTCGAGTTGTAGGCATATCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-609s1c1
Sequence:CCGGGATAGCATAGTTCTTTCCTTTCTCGAGAAAGGAAAGAACTATGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025499.1-899s1c1
Sequence:CCGGGTCATACTTTGAGTTTGTGATCTCGAGATCACAAACTCAAAGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-1111s21c1
Sequence:CCGGTGCAGGAAACAAGGCGTTATACTCGAGTATAACGCCTTGTTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-624s21c1
Sequence:CCGGATTTAGCGACTGCGATGATAGCTCGAGCTATCATCGCAGTCGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-920s21c1
Sequence:CCGGATACTCCAGTGTCATACTTTGCTCGAGCAAAGTATGACACTGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-556s21c1
Sequence:CCGGCCCATTGCCTTCTGCGATTTGCTCGAGCAAATCGCAGAAGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025499.2-704s21c1
Sequence:CCGGCCGAAACGTTCCACTTCATTTCTCGAGAAATGAAGTGGAACGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008394
EID3 MISSION shRNA Bacterial Glycerol Stock
EP300 interacting inhibitor of differentiation 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008394.1-1235s1c1
Sequence:CCGGGAAGCACATATTGTATCTCTTCTCGAGAAGAGATACAATATGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008394.1-1141s1c1
Sequence:CCGGCTATGATTACATACTCCTCATCTCGAGATGAGGAGTATGTAATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008394.1-479s1c1
Sequence:CCGGGCAGTTAAACTCAGATATGAACTCGAGTTCATATCTGAGTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-993s21c1
Sequence:CCGGGAAGACAGGCTGCCAATATTACTCGAGTAATATTGGCAGCCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-922s21c1
Sequence:CCGGCTCGTACTGTGGAGAATATATCTCGAGATATATTCTCCACAGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-1147s21c1
Sequence:CCGGTTACATACTCCTCATACTAAACTCGAGTTTAGTATGAGGAGTATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008394.1-1227s21c1
Sequence:CCGGTGTAAACTGAAGCACATATTGCTCGAGCAATATGTGCTTCAGTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-841s21c1
Sequence:CCGGGATTGTTGCAAACCTACTTTCCTCGAGGAAAGTAGGTTTGCAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008394
EID3 MISSION shRNA shRNA Plasmid DNA
EP300 interacting inhibitor of differentiation 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008394.1-1235s1c1
Sequence:CCGGGAAGCACATATTGTATCTCTTCTCGAGAAGAGATACAATATGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008394.1-1141s1c1
Sequence:CCGGCTATGATTACATACTCCTCATCTCGAGATGAGGAGTATGTAATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008394.1-479s1c1
Sequence:CCGGGCAGTTAAACTCAGATATGAACTCGAGTTCATATCTGAGTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-993s21c1
Sequence:CCGGGAAGACAGGCTGCCAATATTACTCGAGTAATATTGGCAGCCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-922s21c1
Sequence:CCGGCTCGTACTGTGGAGAATATATCTCGAGATATATTCTCCACAGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-1147s21c1
Sequence:CCGGTTACATACTCCTCATACTAAACTCGAGTTTAGTATGAGGAGTATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008394.1-1227s21c1
Sequence:CCGGTGTAAACTGAAGCACATATTGCTCGAGCAATATGTGCTTCAGTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-841s21c1
Sequence:CCGGGATTGTTGCAAACCTACTTTCCTCGAGGAAAGTAGGTTTGCAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008394
EID3 MISSION shRNA Lentiviral Transduction Particles
EP300 interacting inhibitor of differentiation 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008394.1-1235s1c1
Sequence:CCGGGAAGCACATATTGTATCTCTTCTCGAGAAGAGATACAATATGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008394.1-1141s1c1
Sequence:CCGGCTATGATTACATACTCCTCATCTCGAGATGAGGAGTATGTAATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008394.1-479s1c1
Sequence:CCGGGCAGTTAAACTCAGATATGAACTCGAGTTCATATCTGAGTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-993s21c1
Sequence:CCGGGAAGACAGGCTGCCAATATTACTCGAGTAATATTGGCAGCCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-922s21c1
Sequence:CCGGCTCGTACTGTGGAGAATATATCTCGAGATATATTCTCCACAGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-1147s21c1
Sequence:CCGGTTACATACTCCTCATACTAAACTCGAGTTTAGTATGAGGAGTATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008394.1-1227s21c1
Sequence:CCGGTGTAAACTGAAGCACATATTGCTCGAGCAATATGTGCTTCAGTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008394.1-841s21c1
Sequence:CCGGGATTGTTGCAAACCTACTTTCCTCGAGGAAAGTAGGTTTGCAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks