EMAIL THIS PAGE TO A FRIEND

EIF1

eukaryotic translation initiation factor 1

99 Gene Product Result for
Synonyms: A121 EIF-1 EIF1A ISO1 SUI1
UniProtKB ID: P41567, Q9UNQ9
Gene ID:
Mouse(20918) eukaryotic translation initiation factor 1
Rat(287703) eukaryotic translation initiation factor 1
chicken(420037) eukaryotic translation initiation factor 1
cow(509764) eukaryotic translation initiation factor 1
domestic cat(101091666) eukaryotic translation initiation factor 1
dog(403674) eukaryotic translation initiation factor 1
sheep(101118968) eukaryotic translation initiation factor 1
naked mole-rat(101705970) eukaryotic translation initiation factor 1
domestic guinea pig(100713824) eukaryotic translation initiation factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005801 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005801 Rosetta Predictions human pricing
NM_001105837 Rosetta Predictions rat pricing
NM_011508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193438 predicted 728
2 SASI_Hs01_00193439 predicted 389
3 SASI_Hs01_00193440 predicted 373
4 SASI_Hs01_00193441 predicted 745
5 SASI_Hs02_00340308 predicted 528
6 SASI_Hs01_00193442 predicted 751
7 SASI_Hs01_00193443 predicted 1004
8 SASI_Hs01_00193444 predicted 596
9 SASI_Hs01_00193445 predicted 384
10 SASI_Hs01_00193447 predicted 711
11 SASI_Hs01_00193446 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213016 predicted 731
2 SASI_Rn02_00213017 predicted 319
3 SASI_Rn02_00213018 predicted 402
4 SASI_Rn02_00213019 predicted 356
5 SASI_Rn02_00213020 predicted 891
6 SASI_Rn02_00213021 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031577 predicted 908
2 SASI_Mm01_00031578 predicted 844
3 SASI_Mm01_00031579 predicted 955
4 SASI_Mm01_00031580 predicted 780
5 SASI_Mm02_00320816 predicted 762
6 SASI_Mm01_00031582 predicted 871
7 SASI_Mm02_00320817 predicted 665
8 SASI_Mm02_00320818 predicted 676
9 SASI_Mm02_00320819 predicted 665
10 SASI_Mm02_00320820 predicted 744
11 SASI_Mm01_00031581 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005801
VALIDATED
EIF1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-503s21c1
Sequence:CCGGTTAAGTGCTTGTGGCTCACTGCTCGAGCAGTGAGCCACAAGCACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005801.3-401s21c1
Sequence:CCGGTGGAGAAGTAATTCAGCTACACTCGAGTGTAGCTGAATTACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005801.3-687s21c1
Sequence:CCGGTAGTCTTGAAGTCCCTCATTTCTCGAGAAATGAGGGACTTCAAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-600s21c1
Sequence:CCGGCTTGTATAATGTAACCATTTGCTCGAGCAAATGGTTACATTATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-646s21c1
Sequence:CCGGGTAACTCCTTCATGCAATAAACTCGAGTTTATTGCATGAAGGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005801.3-871s21c1
Sequence:CCGGCTGAACAGTCCTCGGTGAATCCTCGAGGATTCACCGAGGACTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005801.2-376s1c1
Sequence:CCGGCCGGAATATGGAGAAGTAATTCTCGAGAATTACTTCTCCATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-361s1c1
Sequence:CCGGACTGTAATTGAGCATCCGGAACTCGAGTTCCGGATGCTCAATTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005801.2-384s1c1
Sequence:CCGGTGGAGAAGTAATTCAGCTACACTCGAGTGTAGCTGAATTACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-438s1c1
Sequence:CCGGCGTAGAGATTGGACTGGCTAACTCGAGTTAGCCAGTCCAATCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-224s1c1
Sequence:CCGGGCACTGAGGATTATATCCATACTCGAGTATGGATATAATCCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005801
VALIDATED
EIF1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-503s21c1
Sequence:CCGGTTAAGTGCTTGTGGCTCACTGCTCGAGCAGTGAGCCACAAGCACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005801.3-401s21c1
Sequence:CCGGTGGAGAAGTAATTCAGCTACACTCGAGTGTAGCTGAATTACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005801.3-687s21c1
Sequence:CCGGTAGTCTTGAAGTCCCTCATTTCTCGAGAAATGAGGGACTTCAAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-600s21c1
Sequence:CCGGCTTGTATAATGTAACCATTTGCTCGAGCAAATGGTTACATTATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-646s21c1
Sequence:CCGGGTAACTCCTTCATGCAATAAACTCGAGTTTATTGCATGAAGGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005801.3-871s21c1
Sequence:CCGGCTGAACAGTCCTCGGTGAATCCTCGAGGATTCACCGAGGACTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005801.2-376s1c1
Sequence:CCGGCCGGAATATGGAGAAGTAATTCTCGAGAATTACTTCTCCATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-361s1c1
Sequence:CCGGACTGTAATTGAGCATCCGGAACTCGAGTTCCGGATGCTCAATTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005801.2-384s1c1
Sequence:CCGGTGGAGAAGTAATTCAGCTACACTCGAGTGTAGCTGAATTACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-438s1c1
Sequence:CCGGCGTAGAGATTGGACTGGCTAACTCGAGTTAGCCAGTCCAATCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-224s1c1
Sequence:CCGGGCACTGAGGATTATATCCATACTCGAGTATGGATATAATCCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005801
VALIDATED
EIF1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-503s21c1
Sequence:CCGGTTAAGTGCTTGTGGCTCACTGCTCGAGCAGTGAGCCACAAGCACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005801.3-401s21c1
Sequence:CCGGTGGAGAAGTAATTCAGCTACACTCGAGTGTAGCTGAATTACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005801.3-687s21c1
Sequence:CCGGTAGTCTTGAAGTCCCTCATTTCTCGAGAAATGAGGGACTTCAAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-600s21c1
Sequence:CCGGCTTGTATAATGTAACCATTTGCTCGAGCAAATGGTTACATTATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005801.3-646s21c1
Sequence:CCGGGTAACTCCTTCATGCAATAAACTCGAGTTTATTGCATGAAGGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005801.3-871s21c1
Sequence:CCGGCTGAACAGTCCTCGGTGAATCCTCGAGGATTCACCGAGGACTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005801.2-376s1c1
Sequence:CCGGCCGGAATATGGAGAAGTAATTCTCGAGAATTACTTCTCCATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-361s1c1
Sequence:CCGGACTGTAATTGAGCATCCGGAACTCGAGTTCCGGATGCTCAATTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005801.2-384s1c1
Sequence:CCGGTGGAGAAGTAATTCAGCTACACTCGAGTGTAGCTGAATTACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-438s1c1
Sequence:CCGGCGTAGAGATTGGACTGGCTAACTCGAGTTAGCCAGTCCAATCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005801.2-224s1c1
Sequence:CCGGGCACTGAGGATTATATCCATACTCGAGTATGGATATAATCCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011508
EIF1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011508.1-850s21c1
Sequence:CCGGACTTGAACAGAATGGGTAACACTCGAGTGTTACCCATTCTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216914    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011508.1-851s1c1
Sequence:CCGGCTTGAACAGAATGGGTAACACCTCGAGGTGTTACCCATTCTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-180s21c1
Sequence:CCGGCCCTTTGCTGATGCAAGTAAGCTCGAGCTTACTTGCATCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-218s21c1
Sequence:CCGGTGCTGGCACTGAGGATTATATCTCGAGATATAATCCTCAGTGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-376s21c1
Sequence:CCGGCAGAATATGGAGAAGTAATTCCTCGAGGAATTACTTCTCCATATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-294s21c1
Sequence:CCGGATCGCTGATGATTACGATAAACTCGAGTTTATCGTAATCATCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011508.1-186s1c1
Sequence:CCGGGCTGATGCAAGTAAGGGTGATCTCGAGATCACCCTTACTTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011508.1-413s1c1
Sequence:CCGGGCGCAAGAACATATGCCAGTTCTCGAGAACTGGCATATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011508
EIF1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011508.1-850s21c1
Sequence:CCGGACTTGAACAGAATGGGTAACACTCGAGTGTTACCCATTCTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216914    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011508.1-851s1c1
Sequence:CCGGCTTGAACAGAATGGGTAACACCTCGAGGTGTTACCCATTCTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-180s21c1
Sequence:CCGGCCCTTTGCTGATGCAAGTAAGCTCGAGCTTACTTGCATCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-218s21c1
Sequence:CCGGTGCTGGCACTGAGGATTATATCTCGAGATATAATCCTCAGTGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-376s21c1
Sequence:CCGGCAGAATATGGAGAAGTAATTCCTCGAGGAATTACTTCTCCATATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-294s21c1
Sequence:CCGGATCGCTGATGATTACGATAAACTCGAGTTTATCGTAATCATCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011508.1-186s1c1
Sequence:CCGGGCTGATGCAAGTAAGGGTGATCTCGAGATCACCCTTACTTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011508.1-413s1c1
Sequence:CCGGGCGCAAGAACATATGCCAGTTCTCGAGAACTGGCATATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011508
EIF1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011508.1-850s21c1
Sequence:CCGGACTTGAACAGAATGGGTAACACTCGAGTGTTACCCATTCTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216914    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011508.1-851s1c1
Sequence:CCGGCTTGAACAGAATGGGTAACACCTCGAGGTGTTACCCATTCTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-180s21c1
Sequence:CCGGCCCTTTGCTGATGCAAGTAAGCTCGAGCTTACTTGCATCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-218s21c1
Sequence:CCGGTGCTGGCACTGAGGATTATATCTCGAGATATAATCCTCAGTGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-376s21c1
Sequence:CCGGCAGAATATGGAGAAGTAATTCCTCGAGGAATTACTTCTCCATATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011508.1-294s21c1
Sequence:CCGGATCGCTGATGATTACGATAAACTCGAGTTTATCGTAATCATCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011508.1-186s1c1
Sequence:CCGGGCTGATGCAAGTAAGGGTGATCTCGAGATCACCCTTACTTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011508.1-413s1c1
Sequence:CCGGGCGCAAGAACATATGCCAGTTCTCGAGAACTGGCATATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks