EMAIL THIS PAGE TO A FRIEND

EIF1AD

eukaryotic translation initiation factor 1A domain containing

69 Gene Product Result for
Synonyms: haponin
UniProtKB ID: Q8N9N8, B2R4N5, Q9BSC1
Gene ID:
Mouse(69860) eukaryotic translation initiation factor 1A domain containing
Rat(293673) eukaryotic translation initiation factor 1A domain containing
sheep(101112176) eukaryotic translation initiation factor 1A domain containing
domestic guinea pig(100735269) eukaryotic translation initiation factor 1A domain containing
naked mole-rat(101705043) eukaryotic translation initiation factor 1A domain containing
Zebrafish(393440) eukaryotic translation initiation factor 1A domain containing
cow(615726) eukaryotic translation initiation factor 1A domain containing
chicken(414740) eukaryotic translation initiation factor 1A domain containing
dog(476017) eukaryotic translation initiation factor 1A domain containing
domestic cat(101080827) eukaryotic translation initiation factor 1A domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032325 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032325 Rosetta Predictions human pricing
NM_001008305 Rosetta Predictions rat pricing
NM_027236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120776 predicted 733
2 SASI_Hs01_00120777 predicted 388
3 SASI_Hs01_00120778 predicted 353
4 SASI_Hs01_00120779 predicted 695
5 SASI_Hs01_00120780 predicted 457
6 SASI_Hs01_00120781 predicted 822
7 SASI_Hs01_00120782 predicted 426
8 SASI_Hs02_00359693 predicted 776
9 SASI_Hs01_00120783 predicted 723
10 SASI_Hs01_00120785 predicted 786
11 SASI_Hs01_00120784 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059785 predicted 1299
2 SASI_Rn01_00059786 predicted 639
3 SASI_Rn01_00059787 predicted 1289
4 SASI_Rn01_00059788 predicted 1192
5 SASI_Rn01_00059789 predicted 705
6 SASI_Rn01_00059790 predicted 978
7 SASI_Rn01_00059791 predicted 1244
8 SASI_Rn01_00059792 predicted 555
9 SASI_Rn01_00059793 predicted 1151
10 SASI_Rn01_00059794 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331799 predicted 1408
2 SASI_Mm02_00331800 predicted 1330
3 SASI_Mm02_00331801 predicted 1402
4 SASI_Mm01_00144967 predicted 1307
5 SASI_Mm02_00331802 predicted 1350
6 SASI_Mm02_00331803 predicted 1357
7 SASI_Mm01_00144970 predicted 1268
8 SASI_Mm02_00331804 predicted 1378
9 SASI_Mm01_00144973 predicted 1296
10 SASI_Mm02_00331805 predicted 1387
11 SASI_Mm01_00144966 predicted 1363
12 SASI_Mm01_00144968 predicted 1337
13 SASI_Mm01_00144969 predicted 555
14 SASI_Mm01_00144971 predicted 1418
15 SASI_Mm01_00144972 predicted 1276
16 SASI_Mm01_00144974 predicted 678
17 SASI_Mm01_00144975 predicted 1413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032325
VALIDATED
EIF1AD MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1A domain containing
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-435s21c1
Sequence:CCGGGGTGAGCATGCCCTCCAAATACTCGAGTATTTGGAGGGCATGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-524s21c1
Sequence:CCGGTGAAGGCTGAAATCTCGTTTGCTCGAGCAAACGAGATTTCAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-780s21c1
Sequence:CCGGCTGAGACTCCAGGACCCAATTCTCGAGAATTGGGTCCTGGAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032325.2-1193s21c1
Sequence:GTACCGGCTTGCAGTTCATACCAATTTACTCGAGTAAATTGGTATGAACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-656s21c1
Sequence:CCGGTCCCAGCTGAGCCACAGTTATCTCGAGATAACTGTGGCTCAGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-525s1c1
Sequence:CCGGGAAGGCTGAAATCTCGTTTGTCTCGAGACAAACGAGATTTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-633s1c1
Sequence:CCGGGAACAGACAAACTCAACCAGACTCGAGTCTGGTTGAGTTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032325.2-2575s1c1
Sequence:CCGGCCTGTCTATTGGATGTGATATCTCGAGATATCACATCCAATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032325.2-697s1c1
Sequence:CCGGGAAGATGATTCTGACCTGTTTCTCGAGAAACAGGTCAGAATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032325.2-523s1c1
Sequence:CCGGGTGAAGGCTGAAATCTCGTTTCTCGAGAAACGAGATTTCAGCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032325.2-1968s1c1
Sequence:CCGGGCACATATCTTCCTGTCGTAACTCGAGTTACGACAGGAAGATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-530s1c1
Sequence:CCGGCTGAAATCTCGTTTGTGCTCTCTCGAGAGAGCACAAACGAGATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032325
VALIDATED
EIF1AD MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1A domain containing
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-435s21c1
Sequence:CCGGGGTGAGCATGCCCTCCAAATACTCGAGTATTTGGAGGGCATGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-524s21c1
Sequence:CCGGTGAAGGCTGAAATCTCGTTTGCTCGAGCAAACGAGATTTCAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-780s21c1
Sequence:CCGGCTGAGACTCCAGGACCCAATTCTCGAGAATTGGGTCCTGGAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032325.2-1193s21c1
Sequence:GTACCGGCTTGCAGTTCATACCAATTTACTCGAGTAAATTGGTATGAACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-656s21c1
Sequence:CCGGTCCCAGCTGAGCCACAGTTATCTCGAGATAACTGTGGCTCAGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-525s1c1
Sequence:CCGGGAAGGCTGAAATCTCGTTTGTCTCGAGACAAACGAGATTTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-633s1c1
Sequence:CCGGGAACAGACAAACTCAACCAGACTCGAGTCTGGTTGAGTTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032325.2-2575s1c1
Sequence:CCGGCCTGTCTATTGGATGTGATATCTCGAGATATCACATCCAATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032325.2-697s1c1
Sequence:CCGGGAAGATGATTCTGACCTGTTTCTCGAGAAACAGGTCAGAATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032325.2-523s1c1
Sequence:CCGGGTGAAGGCTGAAATCTCGTTTCTCGAGAAACGAGATTTCAGCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032325.2-1968s1c1
Sequence:CCGGGCACATATCTTCCTGTCGTAACTCGAGTTACGACAGGAAGATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-530s1c1
Sequence:CCGGCTGAAATCTCGTTTGTGCTCTCTCGAGAGAGCACAAACGAGATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032325
VALIDATED
EIF1AD MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1A domain containing
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-435s21c1
Sequence:CCGGGGTGAGCATGCCCTCCAAATACTCGAGTATTTGGAGGGCATGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-524s21c1
Sequence:CCGGTGAAGGCTGAAATCTCGTTTGCTCGAGCAAACGAGATTTCAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-780s21c1
Sequence:CCGGCTGAGACTCCAGGACCCAATTCTCGAGAATTGGGTCCTGGAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032325.2-1193s21c1
Sequence:GTACCGGCTTGCAGTTCATACCAATTTACTCGAGTAAATTGGTATGAACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032325.2-656s21c1
Sequence:CCGGTCCCAGCTGAGCCACAGTTATCTCGAGATAACTGTGGCTCAGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-525s1c1
Sequence:CCGGGAAGGCTGAAATCTCGTTTGTCTCGAGACAAACGAGATTTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-633s1c1
Sequence:CCGGGAACAGACAAACTCAACCAGACTCGAGTCTGGTTGAGTTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032325.2-2575s1c1
Sequence:CCGGCCTGTCTATTGGATGTGATATCTCGAGATATCACATCCAATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032325.2-697s1c1
Sequence:CCGGGAAGATGATTCTGACCTGTTTCTCGAGAAACAGGTCAGAATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032325.2-523s1c1
Sequence:CCGGGTGAAGGCTGAAATCTCGTTTCTCGAGAAACGAGATTTCAGCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032325.2-1968s1c1
Sequence:CCGGGCACATATCTTCCTGTCGTAACTCGAGTTACGACAGGAAGATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032325.2-530s1c1
Sequence:CCGGCTGAAATCTCGTTTGTGCTCTCTCGAGAGAGCACAAACGAGATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027236
VALIDATED
EIF1AD MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1A domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.2-703s1c1
Sequence:CCGGGCAAGAACATCTGGATCAAGACTCGAGTCTTGATCCAGATGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027236.2-1395s1c1
Sequence:CCGGCTTCATACCTGCTTTCGTTTACTCGAGTAAACGAAAGCAGGTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.1-956s1c1
Sequence:CCGGCCTCTTTGTCAACACCAATCACTCGAGTGATTGGTGTTGACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.1-878s1c1
Sequence:CCGGGAACAGAGAGAGTCAACCAGACTCGAGTCTGGTTGACTCTCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-927s1c1
Sequence:CCGGGAAGGGTCAAGTTCTGAAGATCTCGAGATCTTCAGAACTTGACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-735s1c1
Sequence:CCGGCTCATTGTTGACCCTATTGAACTCGAGTTCAATAGGGTCAACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-597s1c1
Sequence:CCGGGACCACCAGCAAATAGTGAAACTCGAGTTTCACTATTTGCTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-599s1c1
Sequence:CCGGCCACCAGCAAATAGTGAAAGTCTCGAGACTTTCACTATTTGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027236
VALIDATED
EIF1AD MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1A domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.2-703s1c1
Sequence:CCGGGCAAGAACATCTGGATCAAGACTCGAGTCTTGATCCAGATGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027236.2-1395s1c1
Sequence:CCGGCTTCATACCTGCTTTCGTTTACTCGAGTAAACGAAAGCAGGTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.1-956s1c1
Sequence:CCGGCCTCTTTGTCAACACCAATCACTCGAGTGATTGGTGTTGACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.1-878s1c1
Sequence:CCGGGAACAGAGAGAGTCAACCAGACTCGAGTCTGGTTGACTCTCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-927s1c1
Sequence:CCGGGAAGGGTCAAGTTCTGAAGATCTCGAGATCTTCAGAACTTGACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-735s1c1
Sequence:CCGGCTCATTGTTGACCCTATTGAACTCGAGTTCAATAGGGTCAACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-597s1c1
Sequence:CCGGGACCACCAGCAAATAGTGAAACTCGAGTTTCACTATTTGCTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-599s1c1
Sequence:CCGGCCACCAGCAAATAGTGAAAGTCTCGAGACTTTCACTATTTGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027236
VALIDATED
EIF1AD MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1A domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.2-703s1c1
Sequence:CCGGGCAAGAACATCTGGATCAAGACTCGAGTCTTGATCCAGATGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027236.2-1395s1c1
Sequence:CCGGCTTCATACCTGCTTTCGTTTACTCGAGTAAACGAAAGCAGGTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.1-956s1c1
Sequence:CCGGCCTCTTTGTCAACACCAATCACTCGAGTGATTGGTGTTGACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027236.1-878s1c1
Sequence:CCGGGAACAGAGAGAGTCAACCAGACTCGAGTCTGGTTGACTCTCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-927s1c1
Sequence:CCGGGAAGGGTCAAGTTCTGAAGATCTCGAGATCTTCAGAACTTGACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-735s1c1
Sequence:CCGGCTCATTGTTGACCCTATTGAACTCGAGTTCAATAGGGTCAACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-597s1c1
Sequence:CCGGGACCACCAGCAAATAGTGAAACTCGAGTTTCACTATTTGCTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027236.1-599s1c1
Sequence:CCGGCCACCAGCAAATAGTGAAAGTCTCGAGACTTTCACTATTTGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks