EMAIL THIS PAGE TO A FRIEND

EIF1AX

eukaryotic translation initiation factor 1A, X-linked

126 Gene Product Result for
Synonyms: EIF1A EIF1AP1 EIF4C eIF-1A eIF-4C
UniProtKB ID: P47813, B2R5U5, Q0VGC2, Q5JPS5, Q5JPS6
Gene ID:
Human(1964) Summary: This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA. [provided by RefSeq, Jul 2008]
Mouse(66235) eukaryotic translation initiation factor 1A, X-linked
Rat(302697) eukaryotic translation initiation factor 1A, X-linked
dog(611715) eukaryotic translation initiation factor 1A, X-linked
domestic cat(101082291) eukaryotic translation initiation factor 1A, X-linked
cow(511189) eukaryotic translation initiation factor 1A, X-linked
naked mole-rat(101720877) eukaryotic translation initiation factor 1A, X-linked
domestic guinea pig(100720954) eukaryotic translation initiation factor 1A, X-linked
sheep(100270711) eukaryotic translation initiation factor 1A, X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001412 Rosetta Predictions human pricing
NM_001106963 Rosetta Predictions rat pricing
NM_025437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191246 predicted 352
2 SASI_Hs01_00191247 predicted 367
3 SASI_Hs01_00191248 predicted 728
4 SASI_Hs01_00191249 predicted 1043
5 SASI_Hs01_00191250 predicted 1043
6 SASI_Hs01_00191251 predicted 410
7 SASI_Hs01_00191252 predicted 675
8 SASI_Hs02_00331804 predicted 411
9 SASI_Hs01_00191253 predicted 848
10 SASI_Hs01_00191254 predicted 826
11 SASI_Hs01_00191255 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224136 predicted 1117
2 SASI_Rn02_00224137 predicted 505
3 SASI_Rn02_00224138 predicted 1107
4 SASI_Rn02_00224139 predicted 589
5 SASI_Rn02_00224140 predicted 1131
6 SASI_Rn02_00224141 predicted 451
7 SASI_Rn02_00224142 predicted 352
8 SASI_Rn02_00224143 predicted 347
9 SASI_Rn02_00224144 predicted 470
10 SASI_Rn02_00224145 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328260 predicted 494
2 SASI_Mm02_00328261 predicted 698
3 SASI_Mm02_00328262 predicted 580
4 SASI_Mm02_00328263 predicted 447
5 SASI_Mm01_00057553 predicted 300
6 SASI_Mm01_00057555 predicted 460
7 SASI_Mm01_00057557 predicted 500
8 SASI_Mm01_00057559 predicted 457
9 SASI_Mm01_00057560 predicted 337
10 SASI_Mm02_00328264 predicted 489
11 SASI_Mm01_00057551 predicted 753
12 SASI_Mm01_00057552 predicted 732
13 SASI_Mm01_00057554 predicted 891
14 SASI_Mm01_00057556 predicted 903
15 SASI_Mm01_00057558 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025437
VALIDATED
EIF1AX MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1A, X-linked
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-526s1c1
Sequence:CCGGGATACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025437.2-638s1c1
Sequence:CCGGCGGAAGATTGTCCTTCAAGTTCTCGAGAACTTGAAGGACAATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-580s1c1
Sequence:CCGGGATGATGAAGACATCGATGATCTCGAGATCATCGATGTCTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-415s1c1
Sequence:CCGGCGAGATTACCAGGACAACAAACTCGAGTTTGTTGTCCTGGTAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.2-267s1c1
Sequence:CCGGGCAAGAATATGCTCAAGTAATCTCGAGATTACTTGAGCATATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025437.4-672s21c1
Sequence:CCGGCGGAAGATTGTCCTTCAAGTTCTCGAGAACTTGAAGGACAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-560s21c1
Sequence:CCGGGATACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-449s21c1
Sequence:CCGGCGAGATTACCAGGACAACAAACTCGAGTTTGTTGTCCTGGTAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.4-414s1c1
Sequence:CCGGGGATAAATACCTCAGATATCACTCGAGTGATATCTGAGGTATTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.4-461s1c1
Sequence:CCGGGACAACAAAGCCGATGTCATTCTCGAGAATGACATCGGCTTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-614s21c1
Sequence:CCGGGATGATGAAGACATCGATGATCTCGAGATCATCGATGTCTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025437
VALIDATED
EIF1AX MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1A, X-linked
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-526s1c1
Sequence:CCGGGATACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025437.2-638s1c1
Sequence:CCGGCGGAAGATTGTCCTTCAAGTTCTCGAGAACTTGAAGGACAATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-580s1c1
Sequence:CCGGGATGATGAAGACATCGATGATCTCGAGATCATCGATGTCTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-415s1c1
Sequence:CCGGCGAGATTACCAGGACAACAAACTCGAGTTTGTTGTCCTGGTAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.2-267s1c1
Sequence:CCGGGCAAGAATATGCTCAAGTAATCTCGAGATTACTTGAGCATATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025437.4-672s21c1
Sequence:CCGGCGGAAGATTGTCCTTCAAGTTCTCGAGAACTTGAAGGACAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-560s21c1
Sequence:CCGGGATACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-449s21c1
Sequence:CCGGCGAGATTACCAGGACAACAAACTCGAGTTTGTTGTCCTGGTAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.4-414s1c1
Sequence:CCGGGGATAAATACCTCAGATATCACTCGAGTGATATCTGAGGTATTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.4-461s1c1
Sequence:CCGGGACAACAAAGCCGATGTCATTCTCGAGAATGACATCGGCTTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-614s21c1
Sequence:CCGGGATGATGAAGACATCGATGATCTCGAGATCATCGATGTCTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025437
VALIDATED
EIF1AX MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1A, X-linked
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-526s1c1
Sequence:CCGGGATACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025437.2-638s1c1
Sequence:CCGGCGGAAGATTGTCCTTCAAGTTCTCGAGAACTTGAAGGACAATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-580s1c1
Sequence:CCGGGATGATGAAGACATCGATGATCTCGAGATCATCGATGTCTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025437.2-415s1c1
Sequence:CCGGCGAGATTACCAGGACAACAAACTCGAGTTTGTTGTCCTGGTAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.2-267s1c1
Sequence:CCGGGCAAGAATATGCTCAAGTAATCTCGAGATTACTTGAGCATATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025437.4-672s21c1
Sequence:CCGGCGGAAGATTGTCCTTCAAGTTCTCGAGAACTTGAAGGACAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-560s21c1
Sequence:CCGGGATACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-449s21c1
Sequence:CCGGCGAGATTACCAGGACAACAAACTCGAGTTTGTTGTCCTGGTAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.4-414s1c1
Sequence:CCGGGGATAAATACCTCAGATATCACTCGAGTGATATCTGAGGTATTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025437.4-461s1c1
Sequence:CCGGGACAACAAAGCCGATGTCATTCTCGAGAATGACATCGGCTTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025437.4-614s21c1
Sequence:CCGGGATGATGAAGACATCGATGATCTCGAGATCATCGATGTCTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001412
VALIDATED
EIF1AX MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1A, X-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001412.2-285s1c1
Sequence:CCGGCAAAGAGGATGGTCAGGAGTACTCGAGTACTCCTGACCATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-444s1c1
Sequence:CCGGCCGAGACTACCAGGATAACAACTCGAGTTGTTATCCTGGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-335s1c1
Sequence:CCGGGACGGCTAGAAGCAATGTGTTCTCGAGAACACATTGCTTCTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-568s1c1
Sequence:CCGGCCTGGAGATGATGATGAAATTCTCGAGAATTTCATCATCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-372s1c1
Sequence:CCGGGTTATGTCACATCAGAGGAAACTCGAGTTTCCTCTGATGTGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-379s21c1
Sequence:CCGGGTTATGTCACATCAGAGGAAACTCGAGTTTCCTCTGATGTGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-342s21c1
Sequence:CCGGGACGGCTAGAAGCAATGTGTTCTCGAGAACACATTGCTTCTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-451s21c1
Sequence:CCGGCCGAGACTACCAGGATAACAACTCGAGTTGTTATCCTGGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-292s21c1
Sequence:CCGGCAAAGAGGATGGTCAGGAGTACTCGAGTACTCCTGACCATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-575s21c1
Sequence:CCGGCCTGGAGATGATGATGAAATTCTCGAGAATTTCATCATCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001412
VALIDATED
EIF1AX MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1A, X-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001412.2-285s1c1
Sequence:CCGGCAAAGAGGATGGTCAGGAGTACTCGAGTACTCCTGACCATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-444s1c1
Sequence:CCGGCCGAGACTACCAGGATAACAACTCGAGTTGTTATCCTGGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-335s1c1
Sequence:CCGGGACGGCTAGAAGCAATGTGTTCTCGAGAACACATTGCTTCTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-568s1c1
Sequence:CCGGCCTGGAGATGATGATGAAATTCTCGAGAATTTCATCATCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-372s1c1
Sequence:CCGGGTTATGTCACATCAGAGGAAACTCGAGTTTCCTCTGATGTGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-379s21c1
Sequence:CCGGGTTATGTCACATCAGAGGAAACTCGAGTTTCCTCTGATGTGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-342s21c1
Sequence:CCGGGACGGCTAGAAGCAATGTGTTCTCGAGAACACATTGCTTCTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-451s21c1
Sequence:CCGGCCGAGACTACCAGGATAACAACTCGAGTTGTTATCCTGGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-292s21c1
Sequence:CCGGCAAAGAGGATGGTCAGGAGTACTCGAGTACTCCTGACCATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-575s21c1
Sequence:CCGGCCTGGAGATGATGATGAAATTCTCGAGAATTTCATCATCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001412
VALIDATED
EIF1AX MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1A, X-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001412.2-285s1c1
Sequence:CCGGCAAAGAGGATGGTCAGGAGTACTCGAGTACTCCTGACCATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-444s1c1
Sequence:CCGGCCGAGACTACCAGGATAACAACTCGAGTTGTTATCCTGGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-335s1c1
Sequence:CCGGGACGGCTAGAAGCAATGTGTTCTCGAGAACACATTGCTTCTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-568s1c1
Sequence:CCGGCCTGGAGATGATGATGAAATTCTCGAGAATTTCATCATCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001412.2-372s1c1
Sequence:CCGGGTTATGTCACATCAGAGGAAACTCGAGTTTCCTCTGATGTGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-379s21c1
Sequence:CCGGGTTATGTCACATCAGAGGAAACTCGAGTTTCCTCTGATGTGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-342s21c1
Sequence:CCGGGACGGCTAGAAGCAATGTGTTCTCGAGAACACATTGCTTCTAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-451s21c1
Sequence:CCGGCCGAGACTACCAGGATAACAACTCGAGTTGTTATCCTGGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-292s21c1
Sequence:CCGGCAAAGAGGATGGTCAGGAGTACTCGAGTACTCCTGACCATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001412.3-575s21c1
Sequence:CCGGCCTGGAGATGATGATGAAATTCTCGAGAATTTCATCATCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks