EMAIL THIS PAGE TO A FRIEND

EIF1AY

eukaryotic translation initiation factor 1A, Y-linked

35 Gene Product Result for
Synonyms: eIF-4C
UniProtKB ID: O14602, Q9BS77
Gene ID:
Human(9086) Summary: This gene is located on the non-recombining region of the Y chromosome. It encodes a protein related to eukaryotic translation initiation factor 1A (EIF1A), which may function in stabilizing the binding of the initiator Met-tRNA to 40S ribosomal subunits. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
chicken(418606) eukaryotic translation initiation factor 1A, Y-linked
cow(100271756) eukaryotic translation initiation factor 1A, Y-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004681 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128841 MISSION® esiRNA esiRNA human EIF1AY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004681 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083027 predicted 213
2 SASI_Hs01_00083029 predicted 312
3 SASI_Hs01_00083030 predicted 660
4 SASI_Hs01_00083032 predicted 527
5 SASI_Hs01_00083033 predicted 566
6 SASI_Hs01_00083034 predicted 529
7 SASI_Hs01_00083035 predicted 266
8 SASI_Hs01_00083036 predicted 541
9 SASI_Hs02_00338113 predicted 354
10 SASI_Hs02_00338114 predicted 227
11 SASI_Hs01_00083028 predicted 652
12 SASI_Hs01_00083031 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004681
VALIDATED
EIF1AY MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1A, Y-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-445s1c1
Sequence:CCGGGCTAGAAGCCTGAAGGCATATCTCGAGATATGCCTTCAGGCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004681.2-1230s1c1
Sequence:CCGGCCGAACAATAAGTGGCAACCACTCGAGTGGTTGCCACTTATTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-469s1c1
Sequence:CCGGGAGCTTCCAGAACATGCTAAACTCGAGTTTAGCATGTTCTGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004681.2-281s1c1
Sequence:CCGGGACGATTGGAAGCATTGTGTTCTCGAGAACACAATGCTTCCAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-220s1c1
Sequence:CCGGGAGTTGGTGTTTAAAGAGGATCTCGAGATCCTCTTTAAACACCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004681.2-226s1c1
Sequence:CCGGGTGTTTAAAGAGGATGGACAACTCGAGTTGTCCATCCTCTTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004681.2-400s1c1
Sequence:CCGGCAGGATAACAAAGCTGATGTACTCGAGTACATCAGCTTTGTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004681.2-512s1c1
Sequence:CCGGGTCCTGGAGATGATGATGAAACTCGAGTTTCATCATCATCTCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004681.2-502s1c1
Sequence:CCGGGACACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-468s1c1
Sequence:CCGGCGAGCTTCCAGAACATGCTAACTCGAGTTAGCATGTTCTGGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004681
VALIDATED
EIF1AY MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1A, Y-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-445s1c1
Sequence:CCGGGCTAGAAGCCTGAAGGCATATCTCGAGATATGCCTTCAGGCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004681.2-1230s1c1
Sequence:CCGGCCGAACAATAAGTGGCAACCACTCGAGTGGTTGCCACTTATTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-469s1c1
Sequence:CCGGGAGCTTCCAGAACATGCTAAACTCGAGTTTAGCATGTTCTGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004681.2-281s1c1
Sequence:CCGGGACGATTGGAAGCATTGTGTTCTCGAGAACACAATGCTTCCAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-220s1c1
Sequence:CCGGGAGTTGGTGTTTAAAGAGGATCTCGAGATCCTCTTTAAACACCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004681.2-226s1c1
Sequence:CCGGGTGTTTAAAGAGGATGGACAACTCGAGTTGTCCATCCTCTTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004681.2-400s1c1
Sequence:CCGGCAGGATAACAAAGCTGATGTACTCGAGTACATCAGCTTTGTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004681.2-512s1c1
Sequence:CCGGGTCCTGGAGATGATGATGAAACTCGAGTTTCATCATCATCTCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004681.2-502s1c1
Sequence:CCGGGACACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-468s1c1
Sequence:CCGGCGAGCTTCCAGAACATGCTAACTCGAGTTAGCATGTTCTGGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004681
VALIDATED
EIF1AY MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1A, Y-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-445s1c1
Sequence:CCGGGCTAGAAGCCTGAAGGCATATCTCGAGATATGCCTTCAGGCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004681.2-1230s1c1
Sequence:CCGGCCGAACAATAAGTGGCAACCACTCGAGTGGTTGCCACTTATTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-469s1c1
Sequence:CCGGGAGCTTCCAGAACATGCTAAACTCGAGTTTAGCATGTTCTGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004681.2-281s1c1
Sequence:CCGGGACGATTGGAAGCATTGTGTTCTCGAGAACACAATGCTTCCAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-220s1c1
Sequence:CCGGGAGTTGGTGTTTAAAGAGGATCTCGAGATCCTCTTTAAACACCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004681.2-226s1c1
Sequence:CCGGGTGTTTAAAGAGGATGGACAACTCGAGTTGTCCATCCTCTTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004681.2-400s1c1
Sequence:CCGGCAGGATAACAAAGCTGATGTACTCGAGTACATCAGCTTTGTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004681.2-512s1c1
Sequence:CCGGGTCCTGGAGATGATGATGAAACTCGAGTTTCATCATCATCTCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004681.2-502s1c1
Sequence:CCGGGACACATTTGGTCCTGGAGATCTCGAGATCTCCAGGACCAAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004681.2-468s1c1
Sequence:CCGGCGAGCTTCCAGAACATGCTAACTCGAGTTAGCATGTTCTGGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks