EMAIL THIS PAGE TO A FRIEND

EIF1B

eukaryotic translation initiation factor 1B

Synonyms: GC20
UniProtKB ID: O60739, Q9UQF8
Gene ID:
Mouse(68969) eukaryotic translation initiation factor 1B
Rat(301068) eukaryotic translation initiation factor 1B
Zebrafish(322237) eukaryotic translation initiation factor 1B
cow(513481) eukaryotic translation initiation factor 1B
domestic cat(101083796) eukaryotic translation initiation factor 1B
chicken(420715) eukaryotic translation initiation factor 1B
dog(477030) eukaryotic translation initiation factor 1B
sheep(101114218) eukaryotic translation initiation factor 1B
domestic guinea pig(100731228) eukaryotic translation initiation factor 1B
naked mole-rat(101725941) eukaryotic translation initiation factor 1B
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302634 ANTI-EIF1B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005875 Rosetta Predictions human pricing
NM_001106867 Rosetta Predictions rat pricing
NM_026892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115670 predicted 402
2 SASI_Hs01_00115672 predicted 666
3 SASI_Hs01_00115673 predicted 317
4 SASI_Hs01_00115674 predicted 337
5 SASI_Hs02_00340456 predicted 335
6 SASI_Hs01_00115675 predicted 570
7 SASI_Hs02_00340457 predicted 390
8 SASI_Hs01_00115676 predicted 377
9 SASI_Hs01_00115677 predicted 566
10 SASI_Hs01_00115678 predicted 468
11 SASI_Hs01_00115669 predicted 624
12 SASI_Hs01_00115671 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223186 predicted 606
2 SASI_Rn02_00223187 predicted 596
3 SASI_Rn02_00223188 predicted 316
4 SASI_Rn02_00223189 predicted 248
5 SASI_Rn02_00223190 predicted 369
6 SASI_Rn02_00223191 predicted 577
7 SASI_Rn02_00223192 predicted 233
8 SASI_Rn02_00223193 predicted 558
9 SASI_Rn02_00223194 predicted 580
10 SASI_Rn02_00223195 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183510 predicted 592
2 SASI_Mm01_00183511 predicted 306
3 SASI_Mm02_00331162 predicted 495
4 SASI_Mm01_00183513 predicted 572
5 SASI_Mm01_00183515 predicted 558
6 SASI_Mm01_00183517 predicted 576
7 SASI_Mm01_00183519 predicted 369
8 SASI_Mm02_00331163 predicted 375
9 SASI_Mm02_00331164 predicted 521
10 SASI_Mm02_00331165 predicted 383
11 SASI_Mm01_00183512 predicted 376
12 SASI_Mm01_00183514 predicted 230
13 SASI_Mm01_00183516 predicted 436
14 SASI_Mm01_00183518 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005875
VALIDATED
EIF1B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-554s1c1
Sequence:CCGGGAGGAACAGCTTAAGGTTCATCTCGAGATGAACCTTAAGCTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-482s1c1
Sequence:CCGGGAGGTTATTCAGCTTCAAGGTCTCGAGACCTTGAAGCTGAATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005875.1-539s1c1
Sequence:CCGGGTTGGCATTGTAAAGGAGGAACTCGAGTTCCTCCTTTACAATGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-456s1c1
Sequence:CCGGCTGTGATTGAACATCCTGAATCTCGAGATTCAGGATGTTCAATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005875.1-287s1c1
Sequence:CCGGGCAACTAAGGGTGACGACTTACTCGAGTAAGTCGTCACCCTTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005875.1-478s1c1
Sequence:CCGGCGGAGAGGTTATTCAGCTTCACTCGAGTGAAGCTGAATAACCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-475s21c1
Sequence:CCGGCTGTGATTGAACATCCTGAATCTCGAGATTCAGGATGTTCAATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-573s21c1
Sequence:CCGGGAGGAACAGCTTAAGGTTCATCTCGAGATGAACCTTAAGCTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-501s21c1
Sequence:CCGGGAGGTTATTCAGCTTCAAGGTCTCGAGACCTTGAAGCTGAATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-724s21c1
Sequence:CCGGCCATTCACATCTGCATGATTACTCGAGTAATCATGCAGATGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005875.2-307s21c1
Sequence:CCGGCAACTAAGGGTGACGACTTACCTCGAGGTAAGTCGTCACCCTTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005875
VALIDATED
EIF1B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-554s1c1
Sequence:CCGGGAGGAACAGCTTAAGGTTCATCTCGAGATGAACCTTAAGCTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-482s1c1
Sequence:CCGGGAGGTTATTCAGCTTCAAGGTCTCGAGACCTTGAAGCTGAATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005875.1-539s1c1
Sequence:CCGGGTTGGCATTGTAAAGGAGGAACTCGAGTTCCTCCTTTACAATGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-456s1c1
Sequence:CCGGCTGTGATTGAACATCCTGAATCTCGAGATTCAGGATGTTCAATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005875.1-287s1c1
Sequence:CCGGGCAACTAAGGGTGACGACTTACTCGAGTAAGTCGTCACCCTTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005875.1-478s1c1
Sequence:CCGGCGGAGAGGTTATTCAGCTTCACTCGAGTGAAGCTGAATAACCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-475s21c1
Sequence:CCGGCTGTGATTGAACATCCTGAATCTCGAGATTCAGGATGTTCAATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-573s21c1
Sequence:CCGGGAGGAACAGCTTAAGGTTCATCTCGAGATGAACCTTAAGCTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-501s21c1
Sequence:CCGGGAGGTTATTCAGCTTCAAGGTCTCGAGACCTTGAAGCTGAATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-724s21c1
Sequence:CCGGCCATTCACATCTGCATGATTACTCGAGTAATCATGCAGATGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005875.2-307s21c1
Sequence:CCGGCAACTAAGGGTGACGACTTACCTCGAGGTAAGTCGTCACCCTTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005875
VALIDATED
EIF1B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-554s1c1
Sequence:CCGGGAGGAACAGCTTAAGGTTCATCTCGAGATGAACCTTAAGCTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-482s1c1
Sequence:CCGGGAGGTTATTCAGCTTCAAGGTCTCGAGACCTTGAAGCTGAATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005875.1-539s1c1
Sequence:CCGGGTTGGCATTGTAAAGGAGGAACTCGAGTTCCTCCTTTACAATGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005875.1-456s1c1
Sequence:CCGGCTGTGATTGAACATCCTGAATCTCGAGATTCAGGATGTTCAATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005875.1-287s1c1
Sequence:CCGGGCAACTAAGGGTGACGACTTACTCGAGTAAGTCGTCACCCTTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005875.1-478s1c1
Sequence:CCGGCGGAGAGGTTATTCAGCTTCACTCGAGTGAAGCTGAATAACCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-475s21c1
Sequence:CCGGCTGTGATTGAACATCCTGAATCTCGAGATTCAGGATGTTCAATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-573s21c1
Sequence:CCGGGAGGAACAGCTTAAGGTTCATCTCGAGATGAACCTTAAGCTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-501s21c1
Sequence:CCGGGAGGTTATTCAGCTTCAAGGTCTCGAGACCTTGAAGCTGAATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005875.2-724s21c1
Sequence:CCGGCCATTCACATCTGCATGATTACTCGAGTAATCATGCAGATGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005875.2-307s21c1
Sequence:CCGGCAACTAAGGGTGACGACTTACCTCGAGGTAAGTCGTCACCCTTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026892
VALIDATED
EIF1B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 1B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-250s1c1
Sequence:CCGGGACTGAGGACTACATTCATATCTCGAGATATGAATGTAGTCCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-437s1c1
Sequence:CCGGCAAAGGAAGAACATCTGCCAGCTCGAGCTGGCAGATGTTCTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-374s1c1
Sequence:CCGGGCCTGCAATGGAACTGTGATTCTCGAGAATCACAGTTCCATTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026892.3-525s21c1
Sequence:CCGGAGCTGAAGGTTCACGGGTTCTCTCGAGAGAACCCGTGAACCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-435s21c1
Sequence:CCGGCTGAGTACGGAGAGGTTATTCCTCGAGGAATAACCTCTCCGTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-474s21c1
Sequence:CCGGGGAAGAACATCTGCCAGTTTCCTCGAGGAAACTGGCAGATGTTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026892.2-601s1c1
Sequence:CCGGCGACAGACTTTGCGTTTATTTCTCGAGAAATAAACGCAAAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026892.3-633s21c1
Sequence:CCGGACGACAGACTTTGCGTTTATTCTCGAGAATAAACGCAAAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-347s21c1
Sequence:CCGGCAGGGCATTGCGGACGATTATCTCGAGATAATCGTCCGCAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026892
VALIDATED
EIF1B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 1B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-250s1c1
Sequence:CCGGGACTGAGGACTACATTCATATCTCGAGATATGAATGTAGTCCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-437s1c1
Sequence:CCGGCAAAGGAAGAACATCTGCCAGCTCGAGCTGGCAGATGTTCTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-374s1c1
Sequence:CCGGGCCTGCAATGGAACTGTGATTCTCGAGAATCACAGTTCCATTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026892.3-525s21c1
Sequence:CCGGAGCTGAAGGTTCACGGGTTCTCTCGAGAGAACCCGTGAACCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-435s21c1
Sequence:CCGGCTGAGTACGGAGAGGTTATTCCTCGAGGAATAACCTCTCCGTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-474s21c1
Sequence:CCGGGGAAGAACATCTGCCAGTTTCCTCGAGGAAACTGGCAGATGTTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026892.2-601s1c1
Sequence:CCGGCGACAGACTTTGCGTTTATTTCTCGAGAAATAAACGCAAAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026892.3-633s21c1
Sequence:CCGGACGACAGACTTTGCGTTTATTCTCGAGAATAAACGCAAAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-347s21c1
Sequence:CCGGCAGGGCATTGCGGACGATTATCTCGAGATAATCGTCCGCAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026892
VALIDATED
EIF1B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 1B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-250s1c1
Sequence:CCGGGACTGAGGACTACATTCATATCTCGAGATATGAATGTAGTCCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-437s1c1
Sequence:CCGGCAAAGGAAGAACATCTGCCAGCTCGAGCTGGCAGATGTTCTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026892.1-374s1c1
Sequence:CCGGGCCTGCAATGGAACTGTGATTCTCGAGAATCACAGTTCCATTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026892.3-525s21c1
Sequence:CCGGAGCTGAAGGTTCACGGGTTCTCTCGAGAGAACCCGTGAACCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-435s21c1
Sequence:CCGGCTGAGTACGGAGAGGTTATTCCTCGAGGAATAACCTCTCCGTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-474s21c1
Sequence:CCGGGGAAGAACATCTGCCAGTTTCCTCGAGGAAACTGGCAGATGTTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026892.2-601s1c1
Sequence:CCGGCGACAGACTTTGCGTTTATTTCTCGAGAAATAAACGCAAAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026892.3-633s21c1
Sequence:CCGGACGACAGACTTTGCGTTTATTCTCGAGAATAAACGCAAAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026892.3-347s21c1
Sequence:CCGGCAGGGCATTGCGGACGATTATCTCGAGATAATCGTCCGCAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks