EMAIL THIS PAGE TO A FRIEND

EIF2A

eukaryotic translation initiation factor 2A, 65kDa

70 Gene Product Result for
Synonyms: EIF-2A MST089 MSTP004 MSTP089
Gene ID:
Human(83939) Summary: EIF2A is a 65-kD protein that catalyzes the formation of puromycin-sensitive 80S preinitiation complexes (Zoll et al., 2002 [PubMed 12133843]
Mouse(229317) eukaryotic translation initiation factor 2A
Rat(502531) eukaryotic translation initiation factor 2A
Zebrafish(573991) eukaryotic translation initiation factor 2A
dog(477112) eukaryotic translation initiation factor 2A, 65kDa
domestic cat(101094784) eukaryotic translation initiation factor 2A, 65kDa
cow(614746) eukaryotic translation initiation factor 2A, 65kDa
Horse(100050507) eukaryotic translation initiation factor 2A, 65kDa
chicken(425042) eukaryotic translation initiation factor 2A, 65kDa
domestic guinea pig(100721181) eukaryotic translation initiation factor 2A, 65kDa
naked mole-rat(101699237) eukaryotic translation initiation factor 2A, 65kDa
sheep(101119523) eukaryotic translation initiation factor 2A, 65kDa
Domestic Rabbit(100338417) eukaryotic translation initiation factor 2A, 65kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052871 MISSION® esiRNA esiRNA human EIF2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032025 Rosetta Predictions human pricing
NM_001109339 Rosetta Predictions rat pricing
NM_001005509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202426 predicted 960
2 SASI_Hs02_00359211 predicted 1189
3 SASI_Hs01_00202429 predicted 1429
4 SASI_Hs01_00202430 predicted 1523
5 SASI_Hs01_00202431 predicted 1227
6 SASI_Hs01_00202432 predicted 974
7 SASI_Hs01_00202433 predicted 576
8 SASI_Hs02_00359212 predicted 667
9 SASI_Hs02_00359213 predicted 1304
10 SASI_Hs01_00202434 predicted 1179
11 SASI_Hs01_00202427 predicted 342
12 SASI_Hs01_00202428 predicted 420
13 SASI_Hs01_00202435 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247454 predicted 1674
2 SASI_Rn02_00247455 predicted 1273
3 SASI_Rn02_00247456 predicted 362
4 SASI_Rn02_00247457 predicted 369
5 SASI_Rn02_00247458 predicted 738
6 SASI_Rn02_00247459 predicted 1729
7 SASI_Rn02_00247460 predicted 1229
8 SASI_Rn02_00247461 predicted 1110
9 SASI_Rn02_00247462 predicted 1377
10 SASI_Rn02_00247463 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286609 predicted 484
2 SASI_Mm01_00089166 predicted 1796
3 SASI_Mm01_00089168 predicted 580
4 SASI_Mm01_00089169 predicted 439
5 SASI_Mm01_00089170 predicted 450
6 SASI_Mm01_00089172 predicted 1148
7 SASI_Mm02_00286610 predicted 1331
8 SASI_Mm01_00089174 predicted 1083
9 SASI_Mm01_00089175 predicted 697
10 SASI_Mm02_00286611 predicted 1819
11 SASI_Mm01_00089167 predicted 1364
12 SASI_Mm01_00089171 predicted 1263
13 SASI_Mm01_00089173 predicted 1174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032025
VALIDATED
EIF2A MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2A, 65kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032025.3-1197s21c1
Sequence:CCGGGCTCTATCTTGCACAAGTATGCTCGAGCATACTTGTGCAAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032025.3-1754s21c1
Sequence:CCGGGATTTGGAATTGGGTATTTAACTCGAGTTAAATACCCAATTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032025.3-1952s21c1
Sequence:CCGGTTATATCTTGCATCCTATATCCTCGAGGATATAGGATGCAAGATATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-768s1c1
Sequence:CCGGGCTACTGCTGTGTTGGTAATACTCGAGTATTACCAACACAGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-1568s1c1
Sequence:CCGGGCAGGAAGCAAGAAGTGACAACTCGAGTTGTCACTTCTTGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032025.1-1473s1c1
Sequence:CCGGCCTCAGAATATGAAACCACAACTCGAGTTGTGGTTTCATATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032025.1-501s1c1
Sequence:CCGGGCCCGCAATGTTAACAATGAACTCGAGTTCATTGTTAACATTGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-1710s1c1
Sequence:CCGGGCAATCGAACAACTGAAAGAACTCGAGTTCTTTCAGTTGTTCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-654s1c1
Sequence:CCGGGCACCTTCATTTGTTAGATTACTCGAGTAATCTAACAAATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032025.1-190s1c1
Sequence:CCGGGCAAAGTCTGTATCTTTAGTACTCGAGTACTAAAGATACAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032025
VALIDATED
EIF2A MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2A, 65kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032025.3-1197s21c1
Sequence:CCGGGCTCTATCTTGCACAAGTATGCTCGAGCATACTTGTGCAAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032025.3-1754s21c1
Sequence:CCGGGATTTGGAATTGGGTATTTAACTCGAGTTAAATACCCAATTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032025.3-1952s21c1
Sequence:CCGGTTATATCTTGCATCCTATATCCTCGAGGATATAGGATGCAAGATATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-768s1c1
Sequence:CCGGGCTACTGCTGTGTTGGTAATACTCGAGTATTACCAACACAGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-1568s1c1
Sequence:CCGGGCAGGAAGCAAGAAGTGACAACTCGAGTTGTCACTTCTTGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032025.1-1473s1c1
Sequence:CCGGCCTCAGAATATGAAACCACAACTCGAGTTGTGGTTTCATATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032025.1-501s1c1
Sequence:CCGGGCCCGCAATGTTAACAATGAACTCGAGTTCATTGTTAACATTGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-1710s1c1
Sequence:CCGGGCAATCGAACAACTGAAAGAACTCGAGTTCTTTCAGTTGTTCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-654s1c1
Sequence:CCGGGCACCTTCATTTGTTAGATTACTCGAGTAATCTAACAAATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032025.1-190s1c1
Sequence:CCGGGCAAAGTCTGTATCTTTAGTACTCGAGTACTAAAGATACAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032025
VALIDATED
EIF2A MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2A, 65kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032025.3-1197s21c1
Sequence:CCGGGCTCTATCTTGCACAAGTATGCTCGAGCATACTTGTGCAAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032025.3-1754s21c1
Sequence:CCGGGATTTGGAATTGGGTATTTAACTCGAGTTAAATACCCAATTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032025.3-1952s21c1
Sequence:CCGGTTATATCTTGCATCCTATATCCTCGAGGATATAGGATGCAAGATATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-768s1c1
Sequence:CCGGGCTACTGCTGTGTTGGTAATACTCGAGTATTACCAACACAGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-1568s1c1
Sequence:CCGGGCAGGAAGCAAGAAGTGACAACTCGAGTTGTCACTTCTTGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032025.1-1473s1c1
Sequence:CCGGCCTCAGAATATGAAACCACAACTCGAGTTGTGGTTTCATATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032025.1-501s1c1
Sequence:CCGGGCCCGCAATGTTAACAATGAACTCGAGTTCATTGTTAACATTGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-1710s1c1
Sequence:CCGGGCAATCGAACAACTGAAAGAACTCGAGTTCTTTCAGTTGTTCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032025.1-654s1c1
Sequence:CCGGGCACCTTCATTTGTTAGATTACTCGAGTAATCTAACAAATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032025.1-190s1c1
Sequence:CCGGGCAAAGTCTGTATCTTTAGTACTCGAGTACTAAAGATACAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005509
VALIDATED
EIF2A MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2A, 65kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005509.1-809s1c1
Sequence:CCGGCTGCACTACATTGCAACAAATCTCGAGATTTGTTGCAATGTAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005509.1-1186s21c1
Sequence:CCGGACGTGTTAATAATGGGTATAACTCGAGTTATACCCATTATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-1823s21c1
Sequence:CCGGCACTATAAGCAAGTCTCTTAACTCGAGTTAAGAGACTTGCTTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-809s21c1
Sequence:CCGGCTGCACTACATTGCAACAAATCTCGAGATTTGTTGCAATGTAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-738s21c1
Sequence:CCGGCTACTGCTGTGCTGGTAATAGCTCGAGCTATTACCAGCACAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005509.1-1967s1c1
Sequence:CCGGGCATTCTGTATCATGTCAGTACTCGAGTACTGACATGATACAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005509.1-1663s1c1
Sequence:CCGGGAAAGCCATAGAGCAGCTAAACTCGAGTTTAGCTGCTCTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005509
VALIDATED
EIF2A MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2A, 65kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005509.1-809s1c1
Sequence:CCGGCTGCACTACATTGCAACAAATCTCGAGATTTGTTGCAATGTAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005509.1-1186s21c1
Sequence:CCGGACGTGTTAATAATGGGTATAACTCGAGTTATACCCATTATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-1823s21c1
Sequence:CCGGCACTATAAGCAAGTCTCTTAACTCGAGTTAAGAGACTTGCTTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-809s21c1
Sequence:CCGGCTGCACTACATTGCAACAAATCTCGAGATTTGTTGCAATGTAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-738s21c1
Sequence:CCGGCTACTGCTGTGCTGGTAATAGCTCGAGCTATTACCAGCACAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005509.1-1967s1c1
Sequence:CCGGGCATTCTGTATCATGTCAGTACTCGAGTACTGACATGATACAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005509.1-1663s1c1
Sequence:CCGGGAAAGCCATAGAGCAGCTAAACTCGAGTTTAGCTGCTCTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005509
VALIDATED
EIF2A MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2A, 65kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005509.1-809s1c1
Sequence:CCGGCTGCACTACATTGCAACAAATCTCGAGATTTGTTGCAATGTAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005509.1-1186s21c1
Sequence:CCGGACGTGTTAATAATGGGTATAACTCGAGTTATACCCATTATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-1823s21c1
Sequence:CCGGCACTATAAGCAAGTCTCTTAACTCGAGTTAAGAGACTTGCTTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-809s21c1
Sequence:CCGGCTGCACTACATTGCAACAAATCTCGAGATTTGTTGCAATGTAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005509.1-738s21c1
Sequence:CCGGCTACTGCTGTGCTGGTAATAGCTCGAGCTATTACCAGCACAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005509.1-1967s1c1
Sequence:CCGGGCATTCTGTATCATGTCAGTACTCGAGTACTGACATGATACAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005509.1-1663s1c1
Sequence:CCGGGAAAGCCATAGAGCAGCTAAACTCGAGTTTAGCTGCTCTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks