EMAIL THIS PAGE TO A FRIEND

EIF2AK1

eukaryotic translation initiation factor 2-alpha kinase 1

68 Gene Product Result for
Synonyms: HCR HRI
Gene ID:
Human(27102) Summary: The protein encoded by this gene acts at the level of translation initiation to downregulate protein synthesis in response to stress. The encoded protein is a kinase that can be inactivated by hemin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(15467) eukaryotic translation initiation factor 2 alpha kinase 1
Rat(27137) eukaryotic translation initiation factor 2 alpha kinase 1
sheep(101116114) eukaryotic translation initiation factor 2-alpha kinase 1
Domestic Rabbit(100009522) eukaryotic translation initiation factor 2-alpha kinase 1
naked mole-rat(101711605) eukaryotic translation initiation factor 2-alpha kinase 1
domestic guinea pig(100717093) eukaryotic translation initiation factor 2-alpha kinase 1
Zebrafish(565338) eukaryotic translation initiation factor 2-alpha kinase 1
dog(100302056) eukaryotic translation initiation factor 2-alpha kinase 1
cow(507689) eukaryotic translation initiation factor 2-alpha kinase 1
domestic cat(101081103) eukaryotic translation initiation factor 2-alpha kinase 1
chicken(395360) eukaryotic translation initiation factor 2-alpha kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014413 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014413 Rosetta Predictions human pricing
NM_013223 Rosetta Predictions rat pricing
NM_013557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086016 predicted 409
2 SASI_Hs01_00086017 predicted 1563
3 SASI_Hs01_00086018 predicted 2033
4 SASI_Hs01_00086019 predicted 420
5 SASI_Hs01_00086020 predicted 2016
6 SASI_Hs01_00086021 predicted 2043
7 SASI_Hs01_00086022 predicted 972
8 SASI_Hs01_00086023 predicted 998
9 SASI_Hs02_00345604 predicted 1094
10 SASI_Hs01_00086024 predicted 982
11 SASI_Hs01_00086025 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261090 predicted 1421
2 SASI_Rn02_00261091 predicted 1318
3 SASI_Rn02_00261092 predicted 584
4 SASI_Rn02_00261093 predicted 562
5 SASI_Rn02_00261094 predicted 1812
6 SASI_Rn02_00261095 predicted 1555
7 SASI_Rn02_00261096 predicted 458
8 SASI_Rn02_00261097 predicted 379
9 SASI_Rn02_00261098 predicted 495
10 SASI_Rn02_00261099 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172074 predicted 1277
2 SASI_Mm01_00172075 predicted 651
3 SASI_Mm01_00172076 predicted 1016
4 SASI_Mm01_00172078 predicted 569
5 SASI_Mm01_00172079 predicted 1687
6 SASI_Mm01_00172080 predicted 785
7 SASI_Mm01_00172081 predicted 1630
8 SASI_Mm01_00172082 predicted 1653
9 SASI_Mm01_00172083 predicted 282
10 SASI_Mm02_00322284 predicted 412
11 SASI_Mm01_00172077 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014413
VALIDATED
EIF2AK1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2-alpha kinase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-1238s1c1
Sequence:CCGGGGATTGGATAGTCGAGAGAAACTCGAGTTTCTCTCGACTATCCAATCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-799s1c1
Sequence:CCGGGAGCTGCCATTGAGTTGCCATCTCGAGATGGCAACTCAATGGCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-980s1c1
Sequence:CCGGGTACACCACCAATTTAGTCATCTCGAGATGACTAAATTGGTGGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014413.x-337s1c1
Sequence:CCGGAGCTACTTTGCCAGACGTTTACTCGAGTAAACGTCTGGCAAAGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-1335s1c1
Sequence:CCGGGAATTGGTAGAAGGTGTGTTTCTCGAGAAACACACCTTCTACCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014413.2-2023s1c1
Sequence:CCGGGTACAATGCTTCGTTGTATTTCTCGAGAAATACAACGAAGCATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014413.2-2451s1c1
Sequence:CCGGGCTCAACTTCTTAACAGTGTACTCGAGTACACTGTTAAGAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-425s1c1
Sequence:CCGGCAGAGCTATTACTCACTTAATCTCGAGATTAAGTGAGTAATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-851s1c1
Sequence:CCGGCAGAGAGCAATGTGGTGTTAACTCGAGTTAACACCACATTGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-1662s1c1
Sequence:CCGGGCAGAAGTTCTAACAGGTTTACTCGAGTAAACCTGTTAGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014413
VALIDATED
EIF2AK1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2-alpha kinase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-1238s1c1
Sequence:CCGGGGATTGGATAGTCGAGAGAAACTCGAGTTTCTCTCGACTATCCAATCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-799s1c1
Sequence:CCGGGAGCTGCCATTGAGTTGCCATCTCGAGATGGCAACTCAATGGCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-980s1c1
Sequence:CCGGGTACACCACCAATTTAGTCATCTCGAGATGACTAAATTGGTGGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014413.x-337s1c1
Sequence:CCGGAGCTACTTTGCCAGACGTTTACTCGAGTAAACGTCTGGCAAAGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-1335s1c1
Sequence:CCGGGAATTGGTAGAAGGTGTGTTTCTCGAGAAACACACCTTCTACCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014413.2-2023s1c1
Sequence:CCGGGTACAATGCTTCGTTGTATTTCTCGAGAAATACAACGAAGCATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014413.2-2451s1c1
Sequence:CCGGGCTCAACTTCTTAACAGTGTACTCGAGTACACTGTTAAGAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-425s1c1
Sequence:CCGGCAGAGCTATTACTCACTTAATCTCGAGATTAAGTGAGTAATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-851s1c1
Sequence:CCGGCAGAGAGCAATGTGGTGTTAACTCGAGTTAACACCACATTGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-1662s1c1
Sequence:CCGGGCAGAAGTTCTAACAGGTTTACTCGAGTAAACCTGTTAGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014413
VALIDATED
EIF2AK1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2-alpha kinase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-1238s1c1
Sequence:CCGGGGATTGGATAGTCGAGAGAAACTCGAGTTTCTCTCGACTATCCAATCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-799s1c1
Sequence:CCGGGAGCTGCCATTGAGTTGCCATCTCGAGATGGCAACTCAATGGCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-980s1c1
Sequence:CCGGGTACACCACCAATTTAGTCATCTCGAGATGACTAAATTGGTGGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014413.x-337s1c1
Sequence:CCGGAGCTACTTTGCCAGACGTTTACTCGAGTAAACGTCTGGCAAAGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.x-1335s1c1
Sequence:CCGGGAATTGGTAGAAGGTGTGTTTCTCGAGAAACACACCTTCTACCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014413.2-2023s1c1
Sequence:CCGGGTACAATGCTTCGTTGTATTTCTCGAGAAATACAACGAAGCATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014413.2-2451s1c1
Sequence:CCGGGCTCAACTTCTTAACAGTGTACTCGAGTACACTGTTAAGAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-425s1c1
Sequence:CCGGCAGAGCTATTACTCACTTAATCTCGAGATTAAGTGAGTAATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-851s1c1
Sequence:CCGGCAGAGAGCAATGTGGTGTTAACTCGAGTTAACACCACATTGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014413.2-1662s1c1
Sequence:CCGGGCAGAAGTTCTAACAGGTTTACTCGAGTAAACCTGTTAGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013557
VALIDATED
EIF2AK1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2-alpha kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1440s1c1
Sequence:CCGGCCCTATGTTATGGCCAGTGTTCTCGAGAACACTGGCCATAACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1249s1c1
Sequence:CCGGGCTCGGAATTGGAAGGGAATTCTCGAGAATTCCCTTCCAATTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-806s1c1
Sequence:CCGGCCTGATTAAGAGCGCAACTAACTCGAGTTAGTTGCGCTCTTAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-318s1c1
Sequence:CCGGCCCAAGTATGATGAGTCCGATCTCGAGATCGGACTCATCATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1872s1c1
Sequence:CCGGGCCAAGTATATCCAGCTCCTACTCGAGTAGGAGCTGGATATACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-694s21c1
Sequence:CCGGCTGATTAAGAGCGCAACTAAACTCGAGTTTAGTTGCGCTCTTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-573s21c1
Sequence:CCGGACAAACGTCACGCTACTTAAACTCGAGTTTAAGTAGCGTGACGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-1749s21c1
Sequence:CCGGTCCGGTGCAAGCCAAGTATATCTCGAGATATACTTGGCTTGCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-667s21c1
Sequence:CCGGGGTCAGCATTATGCAATTAAGCTCGAGCTTAATTGCATAATGCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013557
VALIDATED
EIF2AK1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2-alpha kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1440s1c1
Sequence:CCGGCCCTATGTTATGGCCAGTGTTCTCGAGAACACTGGCCATAACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1249s1c1
Sequence:CCGGGCTCGGAATTGGAAGGGAATTCTCGAGAATTCCCTTCCAATTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-806s1c1
Sequence:CCGGCCTGATTAAGAGCGCAACTAACTCGAGTTAGTTGCGCTCTTAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-318s1c1
Sequence:CCGGCCCAAGTATGATGAGTCCGATCTCGAGATCGGACTCATCATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1872s1c1
Sequence:CCGGGCCAAGTATATCCAGCTCCTACTCGAGTAGGAGCTGGATATACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-694s21c1
Sequence:CCGGCTGATTAAGAGCGCAACTAAACTCGAGTTTAGTTGCGCTCTTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-573s21c1
Sequence:CCGGACAAACGTCACGCTACTTAAACTCGAGTTTAAGTAGCGTGACGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-1749s21c1
Sequence:CCGGTCCGGTGCAAGCCAAGTATATCTCGAGATATACTTGGCTTGCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-667s21c1
Sequence:CCGGGGTCAGCATTATGCAATTAAGCTCGAGCTTAATTGCATAATGCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013557
VALIDATED
EIF2AK1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2-alpha kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1440s1c1
Sequence:CCGGCCCTATGTTATGGCCAGTGTTCTCGAGAACACTGGCCATAACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1249s1c1
Sequence:CCGGGCTCGGAATTGGAAGGGAATTCTCGAGAATTCCCTTCCAATTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-806s1c1
Sequence:CCGGCCTGATTAAGAGCGCAACTAACTCGAGTTAGTTGCGCTCTTAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-318s1c1
Sequence:CCGGCCCAAGTATGATGAGTCCGATCTCGAGATCGGACTCATCATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013557.1-1872s1c1
Sequence:CCGGGCCAAGTATATCCAGCTCCTACTCGAGTAGGAGCTGGATATACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-694s21c1
Sequence:CCGGCTGATTAAGAGCGCAACTAAACTCGAGTTTAGTTGCGCTCTTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-573s21c1
Sequence:CCGGACAAACGTCACGCTACTTAAACTCGAGTTTAAGTAGCGTGACGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-1749s21c1
Sequence:CCGGTCCGGTGCAAGCCAAGTATATCTCGAGATATACTTGGCTTGCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013557.2-667s21c1
Sequence:CCGGGGTCAGCATTATGCAATTAAGCTCGAGCTTAATTGCATAATGCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks