EMAIL THIS PAGE TO A FRIEND

EIF2AK2

eukaryotic translation initiation factor 2-alpha kinase 2

115 Gene Product Result for
Synonyms: EIF2AK1 PKR PRKR
Gene ID:
Human(5610) Summary: The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(19106) eukaryotic translation initiation factor 2-alpha kinase 2
Rat(54287) eukaryotic translation initiation factor 2-alpha kinase 2
Zebrafish(100001092) eukaryotic translation initiation factor 2-alpha kinase 2
cow(347700) eukaryotic translation initiation factor 2-alpha kinase 2
Horse(100147679) eukaryotic translation initiation factor 2-alpha kinase 2
domestic cat(101082744) eukaryotic translation initiation factor 2-alpha kinase 2
dog(611397) eukaryotic translation initiation factor 2-alpha kinase 2
chicken(395147) eukaryotic translation initiation factor 2-alpha kinase 2
domestic guinea pig(100717384) eukaryotic translation initiation factor 2-alpha kinase 2
naked mole-rat(101724844) eukaryotic translation initiation factor 2-alpha kinase 2
sheep(101121673) eukaryotic translation initiation factor 2-alpha kinase 2
Domestic Rabbit(100009013) eukaryotic translation initiation factor 2-alpha kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E2282 Anti-EIF2AK2 (256-270) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300524 Anti-EIF2AK2 (Ab-446) antibody produced in rabbit affinity isolated antibody rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300533 Anti-EIF2AK2 (Ab-451) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
SAB1412653 ANTI-EIF2AK2 antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV09033 Anti-EIF2AK2 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA019795 Anti-EIF2AK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2100659 Anti-EIF2AK2 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA063893 Anti-EIF2AK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4300222 Anti-phospho-EIF2AK2 (pThr446) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300230 Anti-phospho-EIF2AK2 (pThr451) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4504639 Anti-phospho-PKR (pThr258) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504517 Anti-phospho-PKR (pThr446) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
P6493 Anti-phospho-PKR (pThr451) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, mouse
western blot pricing
SAB4504518 Anti-phospho-PKR (pThr451) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
P0244 Anti-PKR (ET-20) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
P9993 Anti-PKR (KT-16) antibody produced in rabbit 1-2 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human
western blot pricing
SAB1306186 ANTI-PKR (PRKR)(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1306185 ANTI-PKR (PRKR)(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB3500326 Anti-PKR antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502415 Anti-PKR, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
WH0005610M1 Monoclonal Anti-EIF2AK2 antibody produced in mouse clone 1B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404256 Monoclonal Anti-EIF2AK2, (N-terminal) antibody produced in mouse clone 1D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002759 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002759 Rosetta Predictions human pricing
NM_019335 Rosetta Predictions rat pricing
XM_579433 Rosetta Predictions rat pricing
NM_011163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019632 predicted 1304
2 SASI_Hs01_00019634 predicted 546
3 SASI_Hs01_00019635 predicted 1061
4 SASI_Hs01_00019636 predicted 1727
5 SASI_Hs01_00019637 predicted 1537
6 SASI_Hs01_00019638 predicted 1670
7 SASI_Hs01_00019640 predicted 481
8 SASI_Hs01_00019641 predicted 1230
9 SASI_Hs02_00334376 predicted 1638
10 SASI_Hs02_00334377 predicted 768
11 SASI_Hs01_00019633 predicted 1527
12 SASI_Hs01_00019639 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055909 predicted 345
2 SASI_Rn01_00055910 predicted 502
3 SASI_Rn01_00055911 predicted 907
4 SASI_Rn01_00055912 predicted 1006
5 SASI_Rn01_00055913 predicted 1228
6 SASI_Rn01_00055914 predicted 1260
7 SASI_Rn02_00262318 predicted 1781
8 SASI_Rn02_00262319 predicted 314
9 SASI_Rn01_00055916 predicted 1677
10 SASI_Rn01_00055917 predicted 732
11 SASI_Rn01_00055915 predicted 1305
12 SASI_Rn01_00055918 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408556 predicted 915
2 SASI_Rn02_00408557 predicted 899
3 SASI_Rn02_00408558 predicted 995
4 SASI_Rn02_00408559 predicted 1205
5 SASI_Rn02_00408560 predicted 963
6 SASI_Rn02_00408561 predicted 1221
7 SASI_Rn02_00408562 predicted 931
8 SASI_Rn02_00408563 predicted 1259
9 SASI_Rn02_00408564 predicted 1168
10 SASI_Rn02_00408565 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175753 predicted 627
2 SASI_Mm01_00175754 predicted 294
3 SASI_Mm01_00175755 predicted 752
4 SASI_Mm01_00175756 predicted 933
5 SASI_Mm01_00175757 predicted 796
6 SASI_Mm01_00175758 predicted 1123
7 SASI_Mm01_00175759 predicted 1582
8 SASI_Mm01_00175760 predicted 1797
9 SASI_Mm01_00175761 predicted 383
10 SASI_Mm01_00175762 predicted 1314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011163
VALIDATED
EIF2AK2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2-alpha kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-1157s21c1
Sequence:CCGGGCCTCTTTATTCAAATGGAATCTCGAGATTCCATTTGAATAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-1862s21c1
Sequence:CCGGGTGACCCACAGACATTGTATTCTCGAGAATACAATGTCTGTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-250s21c1
Sequence:CCGGGGAGTAGCCATTACGTATAAACTCGAGTTTATACGTAATGGCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-894s21c1
Sequence:CCGGCGCCAGGTTTAACAGCGATTTCTCGAGAAATCGCTGTTAAACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-289s21c1
Sequence:CCGGCCTCCACATGACAGAAGGTTTCTCGAGAAACCTTCTGTCATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011163.2-385s1c1
Sequence:CCGGGCAGCCAAATTAGCTGTTGATCTCGAGATCAACAGCTAATTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-1157s1c1
Sequence:CCGGGCCTCTTTATTCAAATGGAATCTCGAGATTCCATTTGAATAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-289s1c1
Sequence:CCGGCCTCCACATGACAGAAGGTTTCTCGAGAAACCTTCTGTCATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-894s1c1
Sequence:CCGGCGCCAGGTTTAACAGCGATTTCTCGAGAAATCGCTGTTAAACCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011163.2-1005s1c1
Sequence:CCGGCGTTAAATATAACACGGAGAACTCGAGTTCTCCGTGTTATATTTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011163
VALIDATED
EIF2AK2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2-alpha kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-1157s21c1
Sequence:CCGGGCCTCTTTATTCAAATGGAATCTCGAGATTCCATTTGAATAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-1862s21c1
Sequence:CCGGGTGACCCACAGACATTGTATTCTCGAGAATACAATGTCTGTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-250s21c1
Sequence:CCGGGGAGTAGCCATTACGTATAAACTCGAGTTTATACGTAATGGCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-894s21c1
Sequence:CCGGCGCCAGGTTTAACAGCGATTTCTCGAGAAATCGCTGTTAAACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-289s21c1
Sequence:CCGGCCTCCACATGACAGAAGGTTTCTCGAGAAACCTTCTGTCATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011163.2-385s1c1
Sequence:CCGGGCAGCCAAATTAGCTGTTGATCTCGAGATCAACAGCTAATTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-1157s1c1
Sequence:CCGGGCCTCTTTATTCAAATGGAATCTCGAGATTCCATTTGAATAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-289s1c1
Sequence:CCGGCCTCCACATGACAGAAGGTTTCTCGAGAAACCTTCTGTCATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-894s1c1
Sequence:CCGGCGCCAGGTTTAACAGCGATTTCTCGAGAAATCGCTGTTAAACCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011163.2-1005s1c1
Sequence:CCGGCGTTAAATATAACACGGAGAACTCGAGTTCTCCGTGTTATATTTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011163
VALIDATED
EIF2AK2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2-alpha kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-1157s21c1
Sequence:CCGGGCCTCTTTATTCAAATGGAATCTCGAGATTCCATTTGAATAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-1862s21c1
Sequence:CCGGGTGACCCACAGACATTGTATTCTCGAGAATACAATGTCTGTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-250s21c1
Sequence:CCGGGGAGTAGCCATTACGTATAAACTCGAGTTTATACGTAATGGCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-894s21c1
Sequence:CCGGCGCCAGGTTTAACAGCGATTTCTCGAGAAATCGCTGTTAAACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011163.3-289s21c1
Sequence:CCGGCCTCCACATGACAGAAGGTTTCTCGAGAAACCTTCTGTCATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011163.2-385s1c1
Sequence:CCGGGCAGCCAAATTAGCTGTTGATCTCGAGATCAACAGCTAATTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-1157s1c1
Sequence:CCGGGCCTCTTTATTCAAATGGAATCTCGAGATTCCATTTGAATAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-289s1c1
Sequence:CCGGCCTCCACATGACAGAAGGTTTCTCGAGAAACCTTCTGTCATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011163.2-894s1c1
Sequence:CCGGCGCCAGGTTTAACAGCGATTTCTCGAGAAATCGCTGTTAAACCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011163.2-1005s1c1
Sequence:CCGGCGTTAAATATAACACGGAGAACTCGAGTTCTCCGTGTTATATTTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002759
VALIDATED
EIF2AK2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2-alpha kinase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002759.1-2425s1c1
Sequence:CCGGCCTCCTGAGTAGCTGGATTACCTCGAGGTAATCCAGCTACTCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.1-1580s1c1
Sequence:CCGGGAGGCGAGAAACTAGACAAAGCTCGAGCTTTGTCTAGTTTCTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.1-1978s1c1
Sequence:CCGGCTACAGAAATTACTCTCAAAGCTCGAGCTTTGAGAGTAATTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.1-1870s1c1
Sequence:CCGGGCTGAACTTCTTCATGTATGTCTCGAGACATACATGAAGAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.1-595s1c1
Sequence:CCGGGAAGGTGAAGGTAGATCAAAGCTCGAGCTTTGATCTACCTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-2288s1c1
Sequence:CCGGTCCTGGCTCATCTCTTTATTCCTCGAGGAATAAAGAGATGAGCCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-2010s1c1
Sequence:CCGGTCGACCTAACACATCTGAAATCTCGAGATTTCAGATGTGTTAGGTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.x-474s1c1
Sequence:CCGGACTTAATACATACCGTCAGAACTCGAGTTCTGACGGTATGTATTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-1409s1c1
Sequence:CCGGGCTGTTGGGATGGATTTGATTCTCGAGAATCAAATCCATCCCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.x-904s1c1
Sequence:CCGGGCCGCTAAACTTGCATATCTTCTCGAGAAGATATGCAAGTTTAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002759
VALIDATED
EIF2AK2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2-alpha kinase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002759.1-2425s1c1
Sequence:CCGGCCTCCTGAGTAGCTGGATTACCTCGAGGTAATCCAGCTACTCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.1-1580s1c1
Sequence:CCGGGAGGCGAGAAACTAGACAAAGCTCGAGCTTTGTCTAGTTTCTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.1-1978s1c1
Sequence:CCGGCTACAGAAATTACTCTCAAAGCTCGAGCTTTGAGAGTAATTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.1-1870s1c1
Sequence:CCGGGCTGAACTTCTTCATGTATGTCTCGAGACATACATGAAGAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.1-595s1c1
Sequence:CCGGGAAGGTGAAGGTAGATCAAAGCTCGAGCTTTGATCTACCTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-2288s1c1
Sequence:CCGGTCCTGGCTCATCTCTTTATTCCTCGAGGAATAAAGAGATGAGCCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-2010s1c1
Sequence:CCGGTCGACCTAACACATCTGAAATCTCGAGATTTCAGATGTGTTAGGTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.x-474s1c1
Sequence:CCGGACTTAATACATACCGTCAGAACTCGAGTTCTGACGGTATGTATTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-1409s1c1
Sequence:CCGGGCTGTTGGGATGGATTTGATTCTCGAGAATCAAATCCATCCCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.x-904s1c1
Sequence:CCGGGCCGCTAAACTTGCATATCTTCTCGAGAAGATATGCAAGTTTAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002759
VALIDATED
EIF2AK2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2-alpha kinase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002759.1-2425s1c1
Sequence:CCGGCCTCCTGAGTAGCTGGATTACCTCGAGGTAATCCAGCTACTCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.1-1580s1c1
Sequence:CCGGGAGGCGAGAAACTAGACAAAGCTCGAGCTTTGTCTAGTTTCTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.1-1978s1c1
Sequence:CCGGCTACAGAAATTACTCTCAAAGCTCGAGCTTTGAGAGTAATTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.1-1870s1c1
Sequence:CCGGGCTGAACTTCTTCATGTATGTCTCGAGACATACATGAAGAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.1-595s1c1
Sequence:CCGGGAAGGTGAAGGTAGATCAAAGCTCGAGCTTTGATCTACCTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-2288s1c1
Sequence:CCGGTCCTGGCTCATCTCTTTATTCCTCGAGGAATAAAGAGATGAGCCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-2010s1c1
Sequence:CCGGTCGACCTAACACATCTGAAATCTCGAGATTTCAGATGTGTTAGGTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.x-474s1c1
Sequence:CCGGACTTAATACATACCGTCAGAACTCGAGTTCTGACGGTATGTATTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002759.x-1409s1c1
Sequence:CCGGGCTGTTGGGATGGATTTGATTCTCGAGAATCAAATCCATCCCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002759.x-904s1c1
Sequence:CCGGGCCGCTAAACTTGCATATCTTCTCGAGAAGATATGCAAGTTTAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks