EMAIL THIS PAGE TO A FRIEND

EIF2AK3

eukaryotic translation initiation factor 2-alpha kinase 3

118 Gene Product Result for
Synonyms: PEK PERK WRS
Gene ID:
Human(9451) Summary: The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2 (EIF2), leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins. Mutations in this gene are associated with Wolcott-Rallison syndrome. [provided by RefSeq, Jan 2010]
Mouse(13666) eukaryotic translation initiation factor 2 alpha kinase 3
Rat(29702) eukaryotic translation initiation factor 2 alpha kinase 3
sheep(101110042) eukaryotic translation initiation factor 2-alpha kinase 3
naked mole-rat(101713561) eukaryotic translation initiation factor 2-alpha kinase 3
domestic guinea pig(100725836) eukaryotic translation initiation factor 2-alpha kinase 3
Zebrafish(559564) eukaryotic translation initiation factor 2-alpha kinase 3
cow(535820) eukaryotic translation initiation factor 2-alpha kinase 3
Horse(100066488) eukaryotic translation initiation factor 2-alpha kinase 3
domestic cat(101095973) eukaryotic translation initiation factor 2-alpha kinase 3
dog(475756) eukaryotic translation initiation factor 2-alpha kinase 3
chicken(422930) eukaryotic translation initiation factor 2-alpha kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
MTOX1024 HepaRG Cells PERK (-/-) one vial human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004836 Rosetta Predictions human pricing
NM_031599 Rosetta Predictions rat pricing
NM_010121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096844 predicted 1946
2 SASI_Hs01_00096845 predicted 2781
3 SASI_Hs01_00096846 predicted 800
4 SASI_Hs01_00096847 predicted 2388
5 SASI_Hs01_00096848 predicted 1104
6 SASI_Hs01_00096849 predicted 3552
7 SASI_Hs01_00096850 predicted 2523
8 SASI_Hs01_00096851 predicted 1961
9 SASI_Hs02_00338411 predicted 1677
10 SASI_Hs01_00096853 predicted 1016
11 SASI_Hs01_00096852 predicted 2718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064452 predicted 1603
2 SASI_Rn01_00064453 predicted 820
3 SASI_Rn01_00064454 predicted 1575
4 SASI_Rn01_00064455 predicted 1791
5 SASI_Rn01_00064456 predicted 1758
6 SASI_Rn01_00064458 predicted 1935
7 SASI_Rn02_00264878 predicted 3016
8 SASI_Rn01_00064459 predicted 1653
9 SASI_Rn01_00064460 predicted 1449
10 SASI_Rn01_00064461 predicted 740
11 SASI_Rn01_00064457 predicted 2620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138620 predicted 1597
2 SASI_Mm01_00138621 predicted 3261
3 SASI_Mm01_00138623 predicted 2662
4 SASI_Mm01_00138624 predicted 1646
5 SASI_Mm01_00138625 predicted 1906
6 SASI_Mm01_00138626 predicted 1573
7 SASI_Mm01_00138627 predicted 1915
8 SASI_Mm01_00138628 predicted 1934
9 SASI_Mm02_00317839 predicted 2564
10 SASI_Mm01_00138629 predicted 3009
11 SASI_Mm01_00138622 predicted 2672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004836
VALIDATED
EIF2AK3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2-alpha kinase 3
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-4333s1c1
Sequence:CCGGCCGTAGTAAGAAATGGATCATCTCGAGATGATCCATTTCTTACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-1777s1c1
Sequence:CCGGGCACACAGATTACAGTCAGATCTCGAGATCTGACTGTAATCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-3110s1c1
Sequence:CCGGCCTCAAGCCATCCAACATATTCTCGAGAATATGTTGGATGGCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004836.x-3441s1c1
Sequence:CCGGCCTTGTGAGTACGTGATGGTTCTCGAGAACCATCACGTACTCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-1536s1c1
Sequence:CCGGGCTTTGGAATCTGTCACTAATCTCGAGATTAGTGACAGATTCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3525s1c1
Sequence:CCGGGTTGTGCTAGCAACCCTAATACTCGAGTATTAGGGTTGCTAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-4313s1c1
Sequence:CCGGCCCAAACTGATTATAGGTAACCTCGAGGTTACCTATAATCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-470s1c1
Sequence:CCGGCGGCAGGTCATTAGTAATTATCTCGAGATAATTACTAATGACCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3251s1c1
Sequence:CCGGCAGGACCTTAACTGATGTAAGCTCGAGCTTACATCAGTTAAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3160s1c1
Sequence:CCGGGAAACAGCTATTCTCATAAAGCTCGAGCTTTATGAGAATAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004836.4-1219s21c1
Sequence:CCGGTGCATCTGCCTGGTTACTTAACTCGAGTTAAGTAACCAGGCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-2690s21c1
Sequence:CCGGGGCAACCATTGTGCTAATAAACTCGAGTTTATTAGCACAATGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-989s21c1
Sequence:CCGGCACTTTGAACTTCGGTATATTCTCGAGAATATACCGAAGTTCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-3391s21c1
Sequence:CCGGGGAACGACCTGAAGCTATAAACTCGAGTTTATAGCTTCAGGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-3837s21c1
Sequence:CCGGTAGCAGCAATCCCTAATATATCTCGAGATATATTAGGGATTGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-1018s21c1
Sequence:CCGGGGAAACGAGAGCCGGATTTATCTCGAGATAAATCCGGCTCTCGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-1799s21c1
Sequence:CCGGATCATAGCAACAACGTTTATTCTCGAGAATAAACGTTGTTGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-3311s21c1
Sequence:CCGGCTCAAATTTCCACCATTATTTCTCGAGAAATAATGGTGGAAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004836.4-1610s21c1
Sequence:CCGGTCAATCTTGCAGTATCCATATCTCGAGATATGGATACTGCAAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-4003s21c1
Sequence:CCGGTTTGTCCCTGGCGGGTAAATTCTCGAGAATTTACCCGCCAGGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004836
VALIDATED
EIF2AK3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2-alpha kinase 3
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-4333s1c1
Sequence:CCGGCCGTAGTAAGAAATGGATCATCTCGAGATGATCCATTTCTTACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-1777s1c1
Sequence:CCGGGCACACAGATTACAGTCAGATCTCGAGATCTGACTGTAATCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-3110s1c1
Sequence:CCGGCCTCAAGCCATCCAACATATTCTCGAGAATATGTTGGATGGCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004836.x-3441s1c1
Sequence:CCGGCCTTGTGAGTACGTGATGGTTCTCGAGAACCATCACGTACTCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-1536s1c1
Sequence:CCGGGCTTTGGAATCTGTCACTAATCTCGAGATTAGTGACAGATTCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3525s1c1
Sequence:CCGGGTTGTGCTAGCAACCCTAATACTCGAGTATTAGGGTTGCTAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-4313s1c1
Sequence:CCGGCCCAAACTGATTATAGGTAACCTCGAGGTTACCTATAATCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-470s1c1
Sequence:CCGGCGGCAGGTCATTAGTAATTATCTCGAGATAATTACTAATGACCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3251s1c1
Sequence:CCGGCAGGACCTTAACTGATGTAAGCTCGAGCTTACATCAGTTAAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3160s1c1
Sequence:CCGGGAAACAGCTATTCTCATAAAGCTCGAGCTTTATGAGAATAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004836.4-1219s21c1
Sequence:CCGGTGCATCTGCCTGGTTACTTAACTCGAGTTAAGTAACCAGGCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-2690s21c1
Sequence:CCGGGGCAACCATTGTGCTAATAAACTCGAGTTTATTAGCACAATGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-989s21c1
Sequence:CCGGCACTTTGAACTTCGGTATATTCTCGAGAATATACCGAAGTTCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-3391s21c1
Sequence:CCGGGGAACGACCTGAAGCTATAAACTCGAGTTTATAGCTTCAGGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-3837s21c1
Sequence:CCGGTAGCAGCAATCCCTAATATATCTCGAGATATATTAGGGATTGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-1018s21c1
Sequence:CCGGGGAAACGAGAGCCGGATTTATCTCGAGATAAATCCGGCTCTCGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-1799s21c1
Sequence:CCGGATCATAGCAACAACGTTTATTCTCGAGAATAAACGTTGTTGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-3311s21c1
Sequence:CCGGCTCAAATTTCCACCATTATTTCTCGAGAAATAATGGTGGAAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004836.4-1610s21c1
Sequence:CCGGTCAATCTTGCAGTATCCATATCTCGAGATATGGATACTGCAAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-4003s21c1
Sequence:CCGGTTTGTCCCTGGCGGGTAAATTCTCGAGAATTTACCCGCCAGGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004836
VALIDATED
EIF2AK3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2-alpha kinase 3
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-4333s1c1
Sequence:CCGGCCGTAGTAAGAAATGGATCATCTCGAGATGATCCATTTCTTACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-1777s1c1
Sequence:CCGGGCACACAGATTACAGTCAGATCTCGAGATCTGACTGTAATCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-3110s1c1
Sequence:CCGGCCTCAAGCCATCCAACATATTCTCGAGAATATGTTGGATGGCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004836.x-3441s1c1
Sequence:CCGGCCTTGTGAGTACGTGATGGTTCTCGAGAACCATCACGTACTCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.x-1536s1c1
Sequence:CCGGGCTTTGGAATCTGTCACTAATCTCGAGATTAGTGACAGATTCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3525s1c1
Sequence:CCGGGTTGTGCTAGCAACCCTAATACTCGAGTATTAGGGTTGCTAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-4313s1c1
Sequence:CCGGCCCAAACTGATTATAGGTAACCTCGAGGTTACCTATAATCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-470s1c1
Sequence:CCGGCGGCAGGTCATTAGTAATTATCTCGAGATAATTACTAATGACCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3251s1c1
Sequence:CCGGCAGGACCTTAACTGATGTAAGCTCGAGCTTACATCAGTTAAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004836.3-3160s1c1
Sequence:CCGGGAAACAGCTATTCTCATAAAGCTCGAGCTTTATGAGAATAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004836.4-1219s21c1
Sequence:CCGGTGCATCTGCCTGGTTACTTAACTCGAGTTAAGTAACCAGGCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-2690s21c1
Sequence:CCGGGGCAACCATTGTGCTAATAAACTCGAGTTTATTAGCACAATGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-989s21c1
Sequence:CCGGCACTTTGAACTTCGGTATATTCTCGAGAATATACCGAAGTTCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-3391s21c1
Sequence:CCGGGGAACGACCTGAAGCTATAAACTCGAGTTTATAGCTTCAGGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-3837s21c1
Sequence:CCGGTAGCAGCAATCCCTAATATATCTCGAGATATATTAGGGATTGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-1018s21c1
Sequence:CCGGGGAAACGAGAGCCGGATTTATCTCGAGATAAATCCGGCTCTCGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-1799s21c1
Sequence:CCGGATCATAGCAACAACGTTTATTCTCGAGAATAAACGTTGTTGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004836.4-3311s21c1
Sequence:CCGGCTCAAATTTCCACCATTATTTCTCGAGAAATAATGGTGGAAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004836.4-1610s21c1
Sequence:CCGGTCAATCTTGCAGTATCCATATCTCGAGATATGGATACTGCAAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004836.4-4003s21c1
Sequence:CCGGTTTGTCCCTGGCGGGTAAATTCTCGAGAATTTACCCGCCAGGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010121
VALIDATED
EIF2AK3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2-alpha kinase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-3303s1c1
Sequence:CCGGCCTCTACTGTTCACTCAGAAACTCGAGTTTCTGAGTGAACAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010121.1-1602s1c1
Sequence:CCGGCCATACGATAACGGTTACTATCTCGAGATAGTAACCGTTATCGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010121.1-1240s1c1
Sequence:CCGGGCCTGTTTGATGATACAAGTTCTCGAGAACTTGTATCATCAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-3466s1c1
Sequence:CCGGCCATGAGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-964s1c1
Sequence:CCGGGCCACTTTGAACTTCGGTATACTCGAGTATACCGAAGTTCAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-3474s21c1
Sequence:CCGGCCATGAGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010121.2-3972s21c1
Sequence:CCGGGTGACCCATCTGCACTAATTTCTCGAGAAATTAGTGCAGATGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-972s21c1
Sequence:CCGGGCCACTTTGAACTTCGGTATACTCGAGTATACCGAAGTTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-3311s21c1
Sequence:CCGGCCTCTACTGTTCACTCAGAAACTCGAGTTTCTGAGTGAACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010121
VALIDATED
EIF2AK3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2-alpha kinase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-3303s1c1
Sequence:CCGGCCTCTACTGTTCACTCAGAAACTCGAGTTTCTGAGTGAACAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010121.1-1602s1c1
Sequence:CCGGCCATACGATAACGGTTACTATCTCGAGATAGTAACCGTTATCGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010121.1-1240s1c1
Sequence:CCGGGCCTGTTTGATGATACAAGTTCTCGAGAACTTGTATCATCAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-3466s1c1
Sequence:CCGGCCATGAGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-964s1c1
Sequence:CCGGGCCACTTTGAACTTCGGTATACTCGAGTATACCGAAGTTCAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-3474s21c1
Sequence:CCGGCCATGAGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010121.2-3972s21c1
Sequence:CCGGGTGACCCATCTGCACTAATTTCTCGAGAAATTAGTGCAGATGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-972s21c1
Sequence:CCGGGCCACTTTGAACTTCGGTATACTCGAGTATACCGAAGTTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-3311s21c1
Sequence:CCGGCCTCTACTGTTCACTCAGAAACTCGAGTTTCTGAGTGAACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010121
VALIDATED
EIF2AK3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2-alpha kinase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-3303s1c1
Sequence:CCGGCCTCTACTGTTCACTCAGAAACTCGAGTTTCTGAGTGAACAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010121.1-1602s1c1
Sequence:CCGGCCATACGATAACGGTTACTATCTCGAGATAGTAACCGTTATCGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010121.1-1240s1c1
Sequence:CCGGGCCTGTTTGATGATACAAGTTCTCGAGAACTTGTATCATCAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-3466s1c1
Sequence:CCGGCCATGAGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010121.1-964s1c1
Sequence:CCGGGCCACTTTGAACTTCGGTATACTCGAGTATACCGAAGTTCAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-3474s21c1
Sequence:CCGGCCATGAGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010121.2-3972s21c1
Sequence:CCGGGTGACCCATCTGCACTAATTTCTCGAGAAATTAGTGCAGATGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-972s21c1
Sequence:CCGGGCCACTTTGAACTTCGGTATACTCGAGTATACCGAAGTTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010121.2-3311s21c1
Sequence:CCGGCCTCTACTGTTCACTCAGAAACTCGAGTTTCTGAGTGAACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks