EMAIL THIS PAGE TO A FRIEND

EIF2AK4

eukaryotic translation initiation factor 2 alpha kinase 4

Synonyms: GCN2
Gene ID:
Human(440275) Summary: EIF2AK4 belongs to a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2S1; MIM 603907) to downregulate protein synthesis in response to varied cellular stresses (Berlanga et al., 1999 [PubMed 10504407]
Mouse(27103) eukaryotic translation initiation factor 2 alpha kinase 4
Rat(114859) eukaryotic translation initiation factor 2 alpha kinase 4
Zebrafish(100149925) eukaryotic translation initiation factor 2 alpha kinase 4
chicken(423285) eukaryotic translation initiation factor 2 alpha kinase 4
cow(513829) eukaryotic translation initiation factor 2 alpha kinase 4
Horse(100071494) eukaryotic translation initiation factor 2 alpha kinase 4
domestic cat(101087928) eukaryotic translation initiation factor 2 alpha kinase 4
dog(478257) eukaryotic translation initiation factor 2 alpha kinase 4
domestic guinea pig(100736240) eukaryotic translation initiation factor 2 alpha kinase 4
naked mole-rat(101703546) eukaryotic translation initiation factor 2 alpha kinase 4
sheep(101107358) eukaryotic translation initiation factor 2 alpha kinase 4
Domestic Rabbit(100358284) eukaryotic translation initiation factor 2 alpha kinase 4
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013703 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_496066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496066 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
14-934-M GCN2, active 10 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013703 siRNAs that have been validated in the lab human pricing
NM_001105744 Rosetta Predictions rat pricing
NM_013719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013703 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097889 validated 1822
1 SASI_Hs01_00097888 validated 1040
1 SASI_Hs01_00097890 validated 1332
2 SASI_Hs01_00097891 predicted 3888
3 SASI_Hs01_00097892 predicted 3246
4 SASI_Hs01_00097893 predicted 3186
5 SASI_Hs01_00097894 predicted 4692
6 SASI_Hs01_00097895 predicted 1561
7 SASI_Hs01_00097897 predicted 293
8 SASI_Hs02_00306470 predicted 1367
9 SASI_Hs01_00097896 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212106 predicted 311
2 SASI_Rn02_00212107 predicted 286
3 SASI_Rn02_00212108 predicted 321
4 SASI_Rn02_00212109 predicted 278
5 SASI_Rn02_00212110 predicted 329
6 SASI_Rn02_00212111 predicted 309
7 SASI_Rn02_00212112 predicted 340
8 SASI_Rn02_00212113 predicted 277
9 SASI_Rn02_00212114 predicted 350
10 SASI_Rn02_00212115 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128528 predicted 1121
2 SASI_Mm01_00128529 predicted 366
3 SASI_Mm01_00128530 predicted 603
4 SASI_Mm01_00128532 predicted 3623
5 SASI_Mm01_00128533 predicted 3462
6 SASI_Mm01_00128534 predicted 4519
7 SASI_Mm01_00128535 predicted 4021
8 SASI_Mm01_00128536 predicted 4931
9 SASI_Mm01_00128537 predicted 4766
10 SASI_Mm02_00322634 predicted 2395
11 SASI_Mm01_00128531 predicted 4737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013703
VALIDATED
EIF2AK4 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2 alpha kinase 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013703.2-5028s21c1
Sequence:GTACCGGCAAACAGACAGAGGCTTATACCTCGAGGTATAAGCCTCTGTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-334s21c1
Sequence:CCGGCCAAAGGTCTATCAAATGAAACTCGAGTTTCATTTGATAGACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-238s21c1
Sequence:CCGGGCCTAACTGGTGAAGAAGTATCTCGAGATACTTCTTCACCAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-790s21c1
Sequence:CCGGCTAGGCGAGAACGTCAGTATTCTCGAGAATACTGACGTTCTCGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-5001s21c1
Sequence:CCGGCCCTAAAGAACTGTCGTTAACCTCGAGGTTAACGACAGTTCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-1363s21c1
Sequence:CCGGCCGTCAAGATTACGGACTATACTCGAGTATAGTCCGTAATCTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013703
VALIDATED
EIF2AK4 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2 alpha kinase 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013703.2-5028s21c1
Sequence:GTACCGGCAAACAGACAGAGGCTTATACCTCGAGGTATAAGCCTCTGTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-334s21c1
Sequence:CCGGCCAAAGGTCTATCAAATGAAACTCGAGTTTCATTTGATAGACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-238s21c1
Sequence:CCGGGCCTAACTGGTGAAGAAGTATCTCGAGATACTTCTTCACCAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-790s21c1
Sequence:CCGGCTAGGCGAGAACGTCAGTATTCTCGAGAATACTGACGTTCTCGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-5001s21c1
Sequence:CCGGCCCTAAAGAACTGTCGTTAACCTCGAGGTTAACGACAGTTCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-1363s21c1
Sequence:CCGGCCGTCAAGATTACGGACTATACTCGAGTATAGTCCGTAATCTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013703
VALIDATED
EIF2AK4 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2 alpha kinase 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013703.2-5028s21c1
Sequence:GTACCGGCAAACAGACAGAGGCTTATACCTCGAGGTATAAGCCTCTGTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-334s21c1
Sequence:CCGGCCAAAGGTCTATCAAATGAAACTCGAGTTTCATTTGATAGACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-238s21c1
Sequence:CCGGGCCTAACTGGTGAAGAAGTATCTCGAGATACTTCTTCACCAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-790s21c1
Sequence:CCGGCTAGGCGAGAACGTCAGTATTCTCGAGAATACTGACGTTCTCGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-5001s21c1
Sequence:CCGGCCCTAAAGAACTGTCGTTAACCTCGAGGTTAACGACAGTTCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013703.2-1363s21c1
Sequence:CCGGCCGTCAAGATTACGGACTATACTCGAGTATAGTCCGTAATCTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013719
VALIDATED
EIF2AK4 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2 alpha kinase 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013719.2-306s21c1
Sequence:CCGGCAAGTGGAACTGAGGGTTAAACTCGAGTTTAACCCTCAGTTCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-3947s21c1
Sequence:CCGGGTTGGTGAAGTATAGCTTAAACTCGAGTTTAAGCTATACTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-5042s21c1
Sequence:CCGGCTAAAGAACTGCTGCTGTATTCTCGAGAATACAGCAGCAGTTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-385s21c1
Sequence:CCGGTGTCGAATGAAAGTGTTAATTCTCGAGAATTAACACTTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-349s21c1
Sequence:CCGGTAGTTCCCGAAATAGACTTAACTCGAGTTAAGTCTATTTCGGGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-5016s21c1
Sequence:CCGGGACTACTACAGAATCCTATTTCTCGAGAAATAGGATTCTGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-2582s21c1
Sequence:CCGGTCTGGATGGATTAGCTTATATCTCGAGATATAAGCTAATCCATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-4937s21c1
Sequence:CCGGCAAACTCGTCTGCGATGAAATCTCGAGATTTCATCGCAGACGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-3902s1c1
Sequence:CCGGGCCAACCATCAACTCACTAATCTCGAGATTAGTGAGTTGATGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-2574s1c1
Sequence:CCGGCGAGAGATTCTGGATGGATTACTCGAGTAATCCATCCAGAATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-1842s1c1
Sequence:CCGGCGGTACTTCATTGAGTTTGAACTCGAGTTCAAACTCAATGAAGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-382s1c1
Sequence:CCGGGCCTGTCGAATGAAAGTGTTACTCGAGTAACACTTTCATTCGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-3522s1c1
Sequence:CCGGCCTCGGAAGTTAGACCGATTTCTCGAGAAATCGGTCTAACTTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013719
VALIDATED
EIF2AK4 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2 alpha kinase 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013719.2-306s21c1
Sequence:CCGGCAAGTGGAACTGAGGGTTAAACTCGAGTTTAACCCTCAGTTCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-3947s21c1
Sequence:CCGGGTTGGTGAAGTATAGCTTAAACTCGAGTTTAAGCTATACTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-5042s21c1
Sequence:CCGGCTAAAGAACTGCTGCTGTATTCTCGAGAATACAGCAGCAGTTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-385s21c1
Sequence:CCGGTGTCGAATGAAAGTGTTAATTCTCGAGAATTAACACTTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-349s21c1
Sequence:CCGGTAGTTCCCGAAATAGACTTAACTCGAGTTAAGTCTATTTCGGGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-5016s21c1
Sequence:CCGGGACTACTACAGAATCCTATTTCTCGAGAAATAGGATTCTGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-2582s21c1
Sequence:CCGGTCTGGATGGATTAGCTTATATCTCGAGATATAAGCTAATCCATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-4937s21c1
Sequence:CCGGCAAACTCGTCTGCGATGAAATCTCGAGATTTCATCGCAGACGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-3902s1c1
Sequence:CCGGGCCAACCATCAACTCACTAATCTCGAGATTAGTGAGTTGATGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-2574s1c1
Sequence:CCGGCGAGAGATTCTGGATGGATTACTCGAGTAATCCATCCAGAATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-1842s1c1
Sequence:CCGGCGGTACTTCATTGAGTTTGAACTCGAGTTCAAACTCAATGAAGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-382s1c1
Sequence:CCGGGCCTGTCGAATGAAAGTGTTACTCGAGTAACACTTTCATTCGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-3522s1c1
Sequence:CCGGCCTCGGAAGTTAGACCGATTTCTCGAGAAATCGGTCTAACTTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013719
VALIDATED
EIF2AK4 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2 alpha kinase 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013719.2-306s21c1
Sequence:CCGGCAAGTGGAACTGAGGGTTAAACTCGAGTTTAACCCTCAGTTCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-3947s21c1
Sequence:CCGGGTTGGTGAAGTATAGCTTAAACTCGAGTTTAAGCTATACTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-5042s21c1
Sequence:CCGGCTAAAGAACTGCTGCTGTATTCTCGAGAATACAGCAGCAGTTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-385s21c1
Sequence:CCGGTGTCGAATGAAAGTGTTAATTCTCGAGAATTAACACTTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-349s21c1
Sequence:CCGGTAGTTCCCGAAATAGACTTAACTCGAGTTAAGTCTATTTCGGGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-5016s21c1
Sequence:CCGGGACTACTACAGAATCCTATTTCTCGAGAAATAGGATTCTGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-2582s21c1
Sequence:CCGGTCTGGATGGATTAGCTTATATCTCGAGATATAAGCTAATCCATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013719.2-4937s21c1
Sequence:CCGGCAAACTCGTCTGCGATGAAATCTCGAGATTTCATCGCAGACGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-3902s1c1
Sequence:CCGGGCCAACCATCAACTCACTAATCTCGAGATTAGTGAGTTGATGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-2574s1c1
Sequence:CCGGCGAGAGATTCTGGATGGATTACTCGAGTAATCCATCCAGAATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-1842s1c1
Sequence:CCGGCGGTACTTCATTGAGTTTGAACTCGAGTTCAAACTCAATGAAGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-382s1c1
Sequence:CCGGGCCTGTCGAATGAAAGTGTTACTCGAGTAACACTTTCATTCGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013719.1-3522s1c1
Sequence:CCGGCCTCGGAAGTTAGACCGATTTCTCGAGAAATCGGTCTAACTTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496066
VALIDATED
EIF2AK4 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2 alpha kinase 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496066.1-495s1c2
Sequence:CCGGCGATGCAGCAACTTCATTGTTCTCGAGAACAATGAAGTTGCTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_496066.1-475s1c1
Sequence:CCGGCCATGAAAGGAAGAGTCAATCCTCGAGGATTGACTCTTCCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_496066.1-270s1c1
Sequence:CCGGCCAGATGTAGTTCCTGAAATACTCGAGTATTTCAGGAACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496066.1-208s1c1
Sequence:CCGGGCCTAACTGGTGAAGAAGTATCTCGAGATACTTCTTCACCAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_496066.1-304s1c1
Sequence:CCGGCCAAAGGTCTATCAAATGAAACTCGAGTTTCATTTGATAGACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496066.1-405s1c1
Sequence:CCGGCCAACTTTGAAAGAAGTTCAACTCGAGTTGAACTTCTTTCAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496066
VALIDATED
EIF2AK4 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2 alpha kinase 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496066.1-495s1c2
Sequence:CCGGCGATGCAGCAACTTCATTGTTCTCGAGAACAATGAAGTTGCTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_496066.1-475s1c1
Sequence:CCGGCCATGAAAGGAAGAGTCAATCCTCGAGGATTGACTCTTCCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_496066.1-270s1c1
Sequence:CCGGCCAGATGTAGTTCCTGAAATACTCGAGTATTTCAGGAACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496066.1-208s1c1
Sequence:CCGGGCCTAACTGGTGAAGAAGTATCTCGAGATACTTCTTCACCAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_496066.1-304s1c1
Sequence:CCGGCCAAAGGTCTATCAAATGAAACTCGAGTTTCATTTGATAGACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496066.1-405s1c1
Sequence:CCGGCCAACTTTGAAAGAAGTTCAACTCGAGTTGAACTTCTTTCAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496066
VALIDATED
EIF2AK4 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2 alpha kinase 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496066.1-495s1c2
Sequence:CCGGCGATGCAGCAACTTCATTGTTCTCGAGAACAATGAAGTTGCTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_496066.1-475s1c1
Sequence:CCGGCCATGAAAGGAAGAGTCAATCCTCGAGGATTGACTCTTCCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_496066.1-270s1c1
Sequence:CCGGCCAGATGTAGTTCCTGAAATACTCGAGTATTTCAGGAACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496066.1-208s1c1
Sequence:CCGGGCCTAACTGGTGAAGAAGTATCTCGAGATACTTCTTCACCAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_496066.1-304s1c1
Sequence:CCGGCCAAAGGTCTATCAAATGAAACTCGAGTTTCATTTGATAGACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496066.1-405s1c1
Sequence:CCGGCCAACTTTGAAAGAAGTTCAACTCGAGTTGAACTTCTTTCAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks