EMAIL THIS PAGE TO A FRIEND

EIF2B1

eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa

52 Gene Product Result for
Synonyms: EIF2B EIF2BA
UniProtKB ID: Q14232, A6NLY9, Q3SXP4
Gene ID:
Human(1967) Summary: This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Oct 2009]
Mouse(209354) eukaryotic translation initiation factor 2B, subunit 1 (alpha)
Rat(64514) eukaryotic translation initiation factor 2B, subunit 1 alpha
Zebrafish(415150) eukaryotic translation initiation factor 2B, subunit 1 alpha
cow(516670) eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
domestic cat(101100158) eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
dog(477447) eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
chicken(100857736) eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
sheep(101117193) eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
naked mole-rat(101699304) eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
domestic guinea pig(100720303) eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001414 Rosetta Predictions human pricing
NM_172029 Rosetta Predictions rat pricing
NM_145371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331805 predicted 1143
2 SASI_Hs01_00232805 predicted 605
3 SASI_Hs01_00232807 predicted 497
4 SASI_Hs01_00232808 predicted 581
5 SASI_Hs01_00232809 predicted 471
6 SASI_Hs01_00232810 predicted 276
7 SASI_Hs01_00232811 predicted 838
8 SASI_Hs01_00232812 predicted 565
9 SASI_Hs01_00232813 predicted 1035
10 SASI_Hs01_00232814 predicted 298
11 SASI_Hs01_00232806 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269116 predicted 491
2 SASI_Rn01_00052614 predicted 377
3 SASI_Rn01_00052615 predicted 957
4 SASI_Rn01_00052616 predicted 753
5 SASI_Rn01_00052617 predicted 527
6 SASI_Rn01_00052618 predicted 524
7 SASI_Rn01_00052619 predicted 660
8 SASI_Rn02_00269117 predicted 364
9 SASI_Rn01_00052620 predicted 919
10 SASI_Rn01_00052621 predicted 494
11 SASI_Rn01_00052622 predicted 1008
12 SASI_Rn01_00052623 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195299 predicted 775
2 SASI_Mm01_00195300 predicted 346
3 SASI_Mm01_00195301 predicted 635
4 SASI_Mm01_00195302 predicted 302
5 SASI_Mm01_00195303 predicted 510
6 SASI_Mm01_00195304 predicted 472
7 SASI_Mm01_00195305 predicted 936
8 SASI_Mm01_00195306 predicted 742
9 SASI_Mm01_00195307 predicted 881
10 SASI_Mm01_00195308 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145371
EIF2B1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.1-782s1c1
Sequence:CCGGCCCAGATAAGTTTAAGTACAACTCGAGTTGTACTTAAACTTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.1-512s1c1
Sequence:CCGGGCCTGATTTATCTGGTAAGAACTCGAGTTCTTACCAGATAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145371.1-1169s1c1
Sequence:CCGGGAAGGACAACTGAGATTACATCTCGAGATGTAATCTCAGTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.3-184s1c1
Sequence:CCGGCAAATCTCACCTATGCCATAACTCGAGTTATGGCATAGGTGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.3-645s1c1
Sequence:CCGGGTAGAGAACGGAGGCATTATTCTCGAGAATAATGCCTCCGTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-775s21c1
Sequence:CCGGAGGACGTCCCAGATAAGTTTACTCGAGTAAACTTATCTGGGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-645s21c1
Sequence:CCGGGTAGAGAACGGAGGCATTATTCTCGAGAATAATGCCTCCGTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-352s21c1
Sequence:CCGGGAATATCCCTGTCGAGAAATACTCGAGTATTTCTCGACAGGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145371.3-1490s21c1
Sequence:CCGGGAACAATTTAGATACGGTATTCTCGAGAATACCGTATCTAAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145371
EIF2B1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.1-782s1c1
Sequence:CCGGCCCAGATAAGTTTAAGTACAACTCGAGTTGTACTTAAACTTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.1-512s1c1
Sequence:CCGGGCCTGATTTATCTGGTAAGAACTCGAGTTCTTACCAGATAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145371.1-1169s1c1
Sequence:CCGGGAAGGACAACTGAGATTACATCTCGAGATGTAATCTCAGTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.3-184s1c1
Sequence:CCGGCAAATCTCACCTATGCCATAACTCGAGTTATGGCATAGGTGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.3-645s1c1
Sequence:CCGGGTAGAGAACGGAGGCATTATTCTCGAGAATAATGCCTCCGTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-775s21c1
Sequence:CCGGAGGACGTCCCAGATAAGTTTACTCGAGTAAACTTATCTGGGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-645s21c1
Sequence:CCGGGTAGAGAACGGAGGCATTATTCTCGAGAATAATGCCTCCGTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-352s21c1
Sequence:CCGGGAATATCCCTGTCGAGAAATACTCGAGTATTTCTCGACAGGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145371.3-1490s21c1
Sequence:CCGGGAACAATTTAGATACGGTATTCTCGAGAATACCGTATCTAAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145371
EIF2B1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.1-782s1c1
Sequence:CCGGCCCAGATAAGTTTAAGTACAACTCGAGTTGTACTTAAACTTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.1-512s1c1
Sequence:CCGGGCCTGATTTATCTGGTAAGAACTCGAGTTCTTACCAGATAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145371.1-1169s1c1
Sequence:CCGGGAAGGACAACTGAGATTACATCTCGAGATGTAATCTCAGTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.3-184s1c1
Sequence:CCGGCAAATCTCACCTATGCCATAACTCGAGTTATGGCATAGGTGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145371.3-645s1c1
Sequence:CCGGGTAGAGAACGGAGGCATTATTCTCGAGAATAATGCCTCCGTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-775s21c1
Sequence:CCGGAGGACGTCCCAGATAAGTTTACTCGAGTAAACTTATCTGGGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-645s21c1
Sequence:CCGGGTAGAGAACGGAGGCATTATTCTCGAGAATAATGCCTCCGTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145371.3-352s21c1
Sequence:CCGGGAATATCCCTGTCGAGAAATACTCGAGTATTTCTCGACAGGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145371.3-1490s21c1
Sequence:CCGGGAACAATTTAGATACGGTATTCTCGAGAATACCGTATCTAAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001414
VALIDATED
EIF2B1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001414.1-1115s1c1
Sequence:CCGGGCTATTCTAAATCCCAACTTACTCGAGTAAGTTGGGATTTAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001414.1-479s1c1
Sequence:CCGGCCTGATTTGTCAGGTAAGAAACTCGAGTTTCTTACCTGACAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-259s1c1
Sequence:CCGGCTCCGATTACTCCAAATGTAACTCGAGTTACATTTGGAGTAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-745s1c1
Sequence:CCGGCGTCCCAGATAAGTTTAAGTACTCGAGTACTTAAACTTATCTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-478s1c1
Sequence:CCGGGCCTGATTTGTCAGGTAAGAACTCGAGTTCTTACCTGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-878s21c1
Sequence:CCGGCGTCCCAGATAAGTTTAAGTACTCGAGTACTTAAACTTATCTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-392s21c1
Sequence:CCGGCTCCGATTACTCCAAATGTAACTCGAGTTACATTTGGAGTAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-611s21c1
Sequence:CCGGGCCTGATTTGTCAGGTAAGAACTCGAGTTCTTACCTGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001414.2-1248s21c1
Sequence:CCGGGCTATTCTAAATCCCAACTTACTCGAGTAAGTTGGGATTTAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001414
VALIDATED
EIF2B1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001414.1-1115s1c1
Sequence:CCGGGCTATTCTAAATCCCAACTTACTCGAGTAAGTTGGGATTTAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001414.1-479s1c1
Sequence:CCGGCCTGATTTGTCAGGTAAGAAACTCGAGTTTCTTACCTGACAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-259s1c1
Sequence:CCGGCTCCGATTACTCCAAATGTAACTCGAGTTACATTTGGAGTAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-745s1c1
Sequence:CCGGCGTCCCAGATAAGTTTAAGTACTCGAGTACTTAAACTTATCTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-478s1c1
Sequence:CCGGGCCTGATTTGTCAGGTAAGAACTCGAGTTCTTACCTGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-878s21c1
Sequence:CCGGCGTCCCAGATAAGTTTAAGTACTCGAGTACTTAAACTTATCTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-392s21c1
Sequence:CCGGCTCCGATTACTCCAAATGTAACTCGAGTTACATTTGGAGTAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-611s21c1
Sequence:CCGGGCCTGATTTGTCAGGTAAGAACTCGAGTTCTTACCTGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001414.2-1248s21c1
Sequence:CCGGGCTATTCTAAATCCCAACTTACTCGAGTAAGTTGGGATTTAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001414
VALIDATED
EIF2B1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001414.1-1115s1c1
Sequence:CCGGGCTATTCTAAATCCCAACTTACTCGAGTAAGTTGGGATTTAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001414.1-479s1c1
Sequence:CCGGCCTGATTTGTCAGGTAAGAAACTCGAGTTTCTTACCTGACAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-259s1c1
Sequence:CCGGCTCCGATTACTCCAAATGTAACTCGAGTTACATTTGGAGTAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-745s1c1
Sequence:CCGGCGTCCCAGATAAGTTTAAGTACTCGAGTACTTAAACTTATCTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001414.1-478s1c1
Sequence:CCGGGCCTGATTTGTCAGGTAAGAACTCGAGTTCTTACCTGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-878s21c1
Sequence:CCGGCGTCCCAGATAAGTTTAAGTACTCGAGTACTTAAACTTATCTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-392s21c1
Sequence:CCGGCTCCGATTACTCCAAATGTAACTCGAGTTACATTTGGAGTAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001414.2-611s21c1
Sequence:CCGGGCCTGATTTGTCAGGTAAGAACTCGAGTTCTTACCTGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001414.2-1248s21c1
Sequence:CCGGGCTATTCTAAATCCCAACTTACTCGAGTAAGTTGGGATTTAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks