EMAIL THIS PAGE TO A FRIEND

EIF2B2

eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa

63 Gene Product Result for
Synonyms: EIF-2Bbeta EIF2B
UniProtKB ID: P49770, O43201
Gene ID:
Human(8892) Summary: This gene encodes the beta subunit of eukaryotic initiation factor-2B (EIF2B). EIF2B is involved in protein synthesis and exchanges GDP and GTP for its activation and deactivation. [provided by RefSeq, Aug 2011]
Mouse(217715) eukaryotic translation initiation factor 2B, subunit 2 beta
Rat(84005) eukaryotic translation initiation factor 2B, subunit 2 beta
domestic guinea pig(100734729) eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
naked mole-rat(101724125) eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
sheep(101108921) eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Domestic Rabbit(100009318) eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Zebrafish(405839) eukaryotic translation initiation factor 2B, subunit 2 beta
chicken(423359) eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
cow(513958) eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
domestic cat(101096323) eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
dog(490789) eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014239 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014239 Rosetta Predictions human pricing
NM_032058 Rosetta Predictions rat pricing
NM_145445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046763 predicted 775
2 SASI_Hs01_00046765 predicted 657
3 SASI_Hs01_00046766 predicted 472
4 SASI_Hs01_00046767 predicted 708
5 SASI_Hs02_00345279 predicted 701
6 SASI_Hs01_00046768 predicted 607
7 SASI_Hs01_00046769 predicted 437
8 SASI_Hs01_00046770 predicted 749
9 SASI_Hs01_00046771 predicted 568
10 SASI_Hs02_00345280 predicted 626
11 SASI_Hs01_00046762 predicted 635
12 SASI_Hs01_00046764 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036654 predicted 633
2 SASI_Rn01_00036655 predicted 706
3 SASI_Rn01_00036656 predicted 637
4 SASI_Rn01_00036657 predicted 998
5 SASI_Rn01_00036658 predicted 732
6 SASI_Rn02_00265401 predicted 393
7 SASI_Rn02_00265402 predicted 623
8 SASI_Rn01_00036660 predicted 668
9 SASI_Rn01_00036661 predicted 1069
10 SASI_Rn01_00036662 predicted 526
11 SASI_Rn01_00036653 predicted 886
12 SASI_Rn01_00036659 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077355 predicted 641
2 SASI_Mm01_00077357 predicted 882
3 SASI_Mm01_00077358 predicted 431
4 SASI_Mm01_00077359 predicted 431
5 SASI_Mm02_00340834 predicted 915
6 SASI_Mm01_00077360 predicted 397
7 SASI_Mm01_00077361 predicted 738
8 SASI_Mm02_00340835 predicted 531
9 SASI_Mm01_00077363 predicted 277
10 SASI_Mm01_00077364 predicted 665
11 SASI_Mm01_00077356 predicted 716
12 SASI_Mm01_00077362 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145445
EIF2B2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145445.3-1369s21c1
Sequence:CCGGACTTTGCTGGGTTGGTGTTTGCTCGAGCAAACACCAACCCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-696s21c1
Sequence:CCGGTCATGACTGATGCCGCCATTTCTCGAGAAATGGCGGCATCAGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-1002s21c1
Sequence:CCGGCCGACCTCATTACCCTCTTTACTCGAGTAAAGAGGGTAATGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-441s21c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-648s21c1
Sequence:CCGGGACATGAAATGGCCGTCAATTCTCGAGAATTGACGGCCATTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-442s1c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-673s1c1
Sequence:CCGGCCAAAGAAGGTATCGAGACAACTCGAGTTGTCTCGATACCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-483s1c1
Sequence:CCGGGAAGGCACAATGGAGAACATTCTCGAGAATGTTCTCCATTGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-936s1c1
Sequence:CCGGCCTTTCACAGAAGGAGACATTCTCGAGAATGTCTCCTTCTGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145445
EIF2B2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145445.3-1369s21c1
Sequence:CCGGACTTTGCTGGGTTGGTGTTTGCTCGAGCAAACACCAACCCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-696s21c1
Sequence:CCGGTCATGACTGATGCCGCCATTTCTCGAGAAATGGCGGCATCAGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-1002s21c1
Sequence:CCGGCCGACCTCATTACCCTCTTTACTCGAGTAAAGAGGGTAATGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-441s21c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-648s21c1
Sequence:CCGGGACATGAAATGGCCGTCAATTCTCGAGAATTGACGGCCATTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-442s1c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-673s1c1
Sequence:CCGGCCAAAGAAGGTATCGAGACAACTCGAGTTGTCTCGATACCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-483s1c1
Sequence:CCGGGAAGGCACAATGGAGAACATTCTCGAGAATGTTCTCCATTGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-936s1c1
Sequence:CCGGCCTTTCACAGAAGGAGACATTCTCGAGAATGTCTCCTTCTGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145445
EIF2B2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145445.3-1369s21c1
Sequence:CCGGACTTTGCTGGGTTGGTGTTTGCTCGAGCAAACACCAACCCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-696s21c1
Sequence:CCGGTCATGACTGATGCCGCCATTTCTCGAGAAATGGCGGCATCAGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-1002s21c1
Sequence:CCGGCCGACCTCATTACCCTCTTTACTCGAGTAAAGAGGGTAATGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-441s21c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145445.3-648s21c1
Sequence:CCGGGACATGAAATGGCCGTCAATTCTCGAGAATTGACGGCCATTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-442s1c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-673s1c1
Sequence:CCGGCCAAAGAAGGTATCGAGACAACTCGAGTTGTCTCGATACCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-483s1c1
Sequence:CCGGGAAGGCACAATGGAGAACATTCTCGAGAATGTTCTCCATTGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145445.2-936s1c1
Sequence:CCGGCCTTTCACAGAAGGAGACATTCTCGAGAATGTCTCCTTCTGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014239
VALIDATED
EIF2B2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014239.2-1352s21c1
Sequence:CCGGGCAGGGCTTAACTTGTTGATTCTCGAGAATCAACAAGTTAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-917s21c1
Sequence:CCGGCCCAATGAAGAAGACTCATTTCTCGAGAAATGAGTCTTCTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-753s21c1
Sequence:CCGGCCGTTATGTCAAGAGTCAACACTCGAGTGTTGACTCTTGACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-474s21c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014239.1-1316s1c1
Sequence:CCGGGCAGGGCTTAACTTGTTGATTCTCGAGAATCAACAAGTTAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-717s1c1
Sequence:CCGGCCGTTATGTCAAGAGTCAACACTCGAGTGTTGACTCTTGACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-718s1c1
Sequence:CCGGCGTTATGTCAAGAGTCAACAACTCGAGTTGTTGACTCTTGACATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-438s1c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-881s1c1
Sequence:CCGGCCCAATGAAGAAGACTCATTTCTCGAGAAATGAGTCTTCTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014239
VALIDATED
EIF2B2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014239.2-1352s21c1
Sequence:CCGGGCAGGGCTTAACTTGTTGATTCTCGAGAATCAACAAGTTAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-917s21c1
Sequence:CCGGCCCAATGAAGAAGACTCATTTCTCGAGAAATGAGTCTTCTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-753s21c1
Sequence:CCGGCCGTTATGTCAAGAGTCAACACTCGAGTGTTGACTCTTGACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-474s21c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014239.1-1316s1c1
Sequence:CCGGGCAGGGCTTAACTTGTTGATTCTCGAGAATCAACAAGTTAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-717s1c1
Sequence:CCGGCCGTTATGTCAAGAGTCAACACTCGAGTGTTGACTCTTGACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-718s1c1
Sequence:CCGGCGTTATGTCAAGAGTCAACAACTCGAGTTGTTGACTCTTGACATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-438s1c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-881s1c1
Sequence:CCGGCCCAATGAAGAAGACTCATTTCTCGAGAAATGAGTCTTCTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014239
VALIDATED
EIF2B2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014239.2-1352s21c1
Sequence:CCGGGCAGGGCTTAACTTGTTGATTCTCGAGAATCAACAAGTTAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-917s21c1
Sequence:CCGGCCCAATGAAGAAGACTCATTTCTCGAGAAATGAGTCTTCTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-753s21c1
Sequence:CCGGCCGTTATGTCAAGAGTCAACACTCGAGTGTTGACTCTTGACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014239.2-474s21c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014239.1-1316s1c1
Sequence:CCGGGCAGGGCTTAACTTGTTGATTCTCGAGAATCAACAAGTTAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-717s1c1
Sequence:CCGGCCGTTATGTCAAGAGTCAACACTCGAGTGTTGACTCTTGACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-718s1c1
Sequence:CCGGCGTTATGTCAAGAGTCAACAACTCGAGTTGTTGACTCTTGACATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-438s1c1
Sequence:CCGGCCAACATCATTGAGGCGATTACTCGAGTAATCGCCTCAATGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014239.1-881s1c1
Sequence:CCGGCCCAATGAAGAAGACTCATTTCTCGAGAAATGAGTCTTCTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks