EMAIL THIS PAGE TO A FRIEND

EIF2B3

eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa

134 Gene Product Result for
Synonyms: EIF-2B EIF2Bgamma
Gene ID:
Human(8891) Summary: The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(108067) eukaryotic translation initiation factor 2B, subunit 3
Rat(171145) eukaryotic translation initiation factor 2B, subunit 3
Zebrafish(394049) eukaryotic translation initiation factor 2B, subunit 3 gamma
cow(534063) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Horse(100065686) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
domestic cat(101101150) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
chicken(424587) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
dog(475379) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
sheep(101118316) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Domestic Rabbit(100348406) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
naked mole-rat(101704117) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
domestic guinea pig(100723312) eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020365 Rosetta Predictions human pricing
NM_133609 Rosetta Predictions rat pricing
NM_001111277 Rosetta Predictions mouse pricing
NM_175135 Rosetta Predictions mouse pricing
XM_131572 Rosetta Predictions mouse pricing
XM_890706 Rosetta Predictions mouse pricing
XM_899131 Rosetta Predictions mouse pricing
XM_899137 Rosetta Predictions mouse pricing
XM_899147 Rosetta Predictions mouse pricing
XM_899161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045888 predicted 308
2 SASI_Hs01_00045889 predicted 801
3 SASI_Hs01_00045890 predicted 306
4 SASI_Hs01_00045891 predicted 903
5 SASI_Hs01_00045892 predicted 1270
6 SASI_Hs01_00045894 predicted 905
7 SASI_Hs01_00045895 predicted 227
8 SASI_Hs01_00045896 predicted 1382
9 SASI_Hs01_00045897 predicted 1230
10 SASI_Hs02_00353316 predicted 1277
11 SASI_Hs01_00045893 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115183 predicted 782
2 SASI_Rn01_00115184 predicted 768
3 SASI_Rn02_00267831 predicted 1054
4 SASI_Rn01_00115185 predicted 972
5 SASI_Rn02_00267832 predicted 1156
6 SASI_Rn01_00115189 predicted 926
7 SASI_Rn01_00115191 predicted 1193
8 SASI_Rn01_00115192 predicted 1109
9 SASI_Rn02_00267833 predicted 302
10 SASI_Rn02_00267834 predicted 1178
11 SASI_Rn01_00115186 predicted 1190
12 SASI_Rn01_00115187 predicted 1089
13 SASI_Rn01_00115188 predicted 972
14 SASI_Rn01_00115190 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306632 predicted 759
2 SASI_Mm02_00306633 predicted 997
3 SASI_Mm02_00306634 predicted 740
4 SASI_Mm02_00306635 predicted 197
5 SASI_Mm02_00306636 predicted 940
6 SASI_Mm02_00306637 predicted 255
7 SASI_Mm02_00306638 predicted 254
8 SASI_Mm02_00306639 predicted 749
9 SASI_Mm02_00306640 predicted 930
10 SASI_Mm02_00306641 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345759 predicted 756
2 SASI_Mm02_00345760 predicted 992
3 SASI_Mm02_00345761 predicted 733
4 SASI_Mm02_00345762 predicted 202
5 SASI_Mm02_00345763 predicted 945
6 SASI_Mm02_00345764 predicted 260
7 SASI_Mm02_00345765 predicted 256
8 SASI_Mm02_00345766 predicted 748
9 SASI_Mm02_00345767 predicted 938
10 SASI_Mm02_00345768 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274345 predicted 680
2 SASI_Mm01_00274346 predicted 413
3 SASI_Mm01_00274347 predicted 620
4 SASI_Mm01_00274348 predicted 914
5 SASI_Mm01_00274349 predicted 1008
6 SASI_Mm01_00274350 predicted 1212
7 SASI_Mm01_00274351 predicted 1087
8 SASI_Mm01_00274352 predicted 764
9 SASI_Mm01_00274353 predicted 844
10 SASI_Mm01_00274354 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210437 predicted 764
2 SASI_Mm01_00210438 predicted 1006
3 SASI_Mm01_00210439 predicted 752
4 SASI_Mm01_00210440 predicted 950
5 SASI_Mm01_00210441 predicted 987
6 SASI_Mm01_00210442 predicted 1091
7 SASI_Mm01_00210443 predicted 1167
8 SASI_Mm01_00210444 predicted 1183
9 SASI_Mm01_00210445 predicted 869
10 SASI_Mm01_00210446 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245921 predicted 998
2 SASI_Mm01_00245922 predicted 1643
3 SASI_Mm01_00245923 predicted 1826
4 SASI_Mm01_00245924 predicted 1818
5 SASI_Mm01_00245925 predicted 1786
6 SASI_Mm01_00245926 predicted 1084
7 SASI_Mm01_00245927 predicted 1157
8 SASI_Mm01_00245928 predicted 1725
9 SASI_Mm01_00245929 predicted 1164
10 SASI_Mm01_00245930 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238318 predicted 1008
2 SASI_Mm01_00238319 predicted 752
3 SASI_Mm01_00238320 predicted 957
4 SASI_Mm01_00238321 predicted 1252
5 SASI_Mm01_00238322 predicted 1338
6 SASI_Mm01_00238323 predicted 1535
7 SASI_Mm01_00238324 predicted 1415
8 SASI_Mm01_00238325 predicted 1096
9 SASI_Mm01_00238326 predicted 1167
10 SASI_Mm01_00238327 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259908 predicted 273
2 SASI_Mm01_00259909 predicted 215
3 SASI_Mm01_00259910 predicted 272
4 SASI_Mm01_00259911 predicted 235
5 SASI_Mm01_00259912 predicted 277
6 SASI_Mm01_00259913 predicted 304
7 SASI_Mm01_00259914 predicted 206
8 SASI_Mm01_00259915 predicted 300
9 SASI_Mm01_00259916 predicted 245
10 SASI_Mm01_00259917 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215157 predicted 1010
2 SASI_Mm01_00215158 predicted 743
3 SASI_Mm01_00215159 predicted 958
4 SASI_Mm01_00215160 predicted 1251
5 SASI_Mm01_00215161 predicted 1099
6 SASI_Mm01_00215162 predicted 1169
7 SASI_Mm01_00215163 predicted 1274
8 SASI_Mm01_00215164 predicted 1182
9 SASI_Mm01_00215165 predicted 1228
10 SASI_Mm01_00215166 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020365
VALIDATED
EIF2B3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-775s1c1
Sequence:CCGGCGGAGTGAACTGATTCCATATCTCGAGATATGGAATCAGTTCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020365.1-361s1c1
Sequence:CCGGGCAGATTCTTTGCGCTACATACTCGAGTATGTAGCGCAAAGAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-1402s1c1
Sequence:CCGGGCCAAAGCTAAACGAGTGAATCTCGAGATTCACTCGTTTAGCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020365.1-706s1c1
Sequence:CCGGGCCCACCTCTACTGTTTGAAACTCGAGTTTCAAACAGTAGAGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-187s1c1
Sequence:CCGGCCAGTTGGGAACAAACCTTTACTCGAGTAAAGGTTTGTTCCCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020365.2-1427s21c1
Sequence:CCGGGCCAAAGCTAAACGAGTGAATCTCGAGATTCACTCGTTTAGCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-731s21c1
Sequence:CCGGGCCCACCTCTACTGTTTGAAACTCGAGTTTCAAACAGTAGAGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-212s21c1
Sequence:CCGGCCAGTTGGGAACAAACCTTTACTCGAGTAAAGGTTTGTTCCCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-386s21c1
Sequence:CCGGGCAGATTCTTTGCGCTACATACTCGAGTATGTAGCGCAAAGAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020365.2-800s21c1
Sequence:CCGGCGGAGTGAACTGATTCCATATCTCGAGATATGGAATCAGTTCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020365
VALIDATED
EIF2B3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-775s1c1
Sequence:CCGGCGGAGTGAACTGATTCCATATCTCGAGATATGGAATCAGTTCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020365.1-361s1c1
Sequence:CCGGGCAGATTCTTTGCGCTACATACTCGAGTATGTAGCGCAAAGAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-1402s1c1
Sequence:CCGGGCCAAAGCTAAACGAGTGAATCTCGAGATTCACTCGTTTAGCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020365.1-706s1c1
Sequence:CCGGGCCCACCTCTACTGTTTGAAACTCGAGTTTCAAACAGTAGAGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-187s1c1
Sequence:CCGGCCAGTTGGGAACAAACCTTTACTCGAGTAAAGGTTTGTTCCCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020365.2-1427s21c1
Sequence:CCGGGCCAAAGCTAAACGAGTGAATCTCGAGATTCACTCGTTTAGCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-731s21c1
Sequence:CCGGGCCCACCTCTACTGTTTGAAACTCGAGTTTCAAACAGTAGAGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-212s21c1
Sequence:CCGGCCAGTTGGGAACAAACCTTTACTCGAGTAAAGGTTTGTTCCCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-386s21c1
Sequence:CCGGGCAGATTCTTTGCGCTACATACTCGAGTATGTAGCGCAAAGAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020365.2-800s21c1
Sequence:CCGGCGGAGTGAACTGATTCCATATCTCGAGATATGGAATCAGTTCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020365
VALIDATED
EIF2B3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-775s1c1
Sequence:CCGGCGGAGTGAACTGATTCCATATCTCGAGATATGGAATCAGTTCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020365.1-361s1c1
Sequence:CCGGGCAGATTCTTTGCGCTACATACTCGAGTATGTAGCGCAAAGAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-1402s1c1
Sequence:CCGGGCCAAAGCTAAACGAGTGAATCTCGAGATTCACTCGTTTAGCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020365.1-706s1c1
Sequence:CCGGGCCCACCTCTACTGTTTGAAACTCGAGTTTCAAACAGTAGAGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020365.1-187s1c1
Sequence:CCGGCCAGTTGGGAACAAACCTTTACTCGAGTAAAGGTTTGTTCCCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020365.2-1427s21c1
Sequence:CCGGGCCAAAGCTAAACGAGTGAATCTCGAGATTCACTCGTTTAGCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-731s21c1
Sequence:CCGGGCCCACCTCTACTGTTTGAAACTCGAGTTTCAAACAGTAGAGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-212s21c1
Sequence:CCGGCCAGTTGGGAACAAACCTTTACTCGAGTAAAGGTTTGTTCCCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020365.2-386s21c1
Sequence:CCGGGCAGATTCTTTGCGCTACATACTCGAGTATGTAGCGCAAAGAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020365.2-800s21c1
Sequence:CCGGCGGAGTGAACTGATTCCATATCTCGAGATATGGAATCAGTTCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111277
VALIDATED
EIF2B3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-643s21c1
Sequence:CCGGGAAGCACCCTAGGATACATTTCTCGAGAAATGTATCCTAGGGTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-820s21c1
Sequence:CCGGAGACAAAGAAGAGGATCTAAACTCGAGTTTAGATCCTCTTCTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-1150s21c1
Sequence:CCGGCATCGGGCCAGATACACAAATCTCGAGATTTGTGTATCTGGCCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-1220s21c1
Sequence:CCGGATACGAGACAGAACGTCTATTCTCGAGAATAGACGTTCTGTCTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111277.1-607s21c1
Sequence:CCGGGGATGAAGAGCTGGTCATTAACTCGAGTTAATGACCAGCTCTTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111277
VALIDATED
EIF2B3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-643s21c1
Sequence:CCGGGAAGCACCCTAGGATACATTTCTCGAGAAATGTATCCTAGGGTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-820s21c1
Sequence:CCGGAGACAAAGAAGAGGATCTAAACTCGAGTTTAGATCCTCTTCTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-1150s21c1
Sequence:CCGGCATCGGGCCAGATACACAAATCTCGAGATTTGTGTATCTGGCCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-1220s21c1
Sequence:CCGGATACGAGACAGAACGTCTATTCTCGAGAATAGACGTTCTGTCTCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111277.1-607s21c1
Sequence:CCGGGGATGAAGAGCTGGTCATTAACTCGAGTTAATGACCAGCTCTTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111277
VALIDATED
EIF2B3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-643s21c1
Sequence:CCGGGAAGCACCCTAGGATACATTTCTCGAGAAATGTATCCTAGGGTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-820s21c1
Sequence:CCGGAGACAAAGAAGAGGATCTAAACTCGAGTTTAGATCCTCTTCTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-1150s21c1
Sequence:CCGGCATCGGGCCAGATACACAAATCTCGAGATTTGTGTATCTGGCCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111277.1-1220s21c1
Sequence:CCGGATACGAGACAGAACGTCTATTCTCGAGAATAGACGTTCTGTCTCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111277.1-607s21c1
Sequence:CCGGGGATGAAGAGCTGGTCATTAACTCGAGTTAATGACCAGCTCTTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)