EMAIL THIS PAGE TO A FRIEND

EIF2B5

eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa

Synonyms: CACH CLE EIF-2B EIF2Bepsilon LVWM
UniProtKB ID: Q13144, Q541Z1, Q96D04
Gene ID:
Human(8893) Summary: This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Nov 2009]
Mouse(224045) eukaryotic translation initiation factor 2B, subunit 5 epsilon
Rat(192234) eukaryotic translation initiation factor 2B, subunit 5 epsilon
Zebrafish(563613) eukaryotic translation initiation factor 2B, subunit 5 epsilon
cow(783760) eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
domestic cat(101089136) eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
dog(488103) eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
chicken(424948) eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
sheep(101108187) eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
Domestic Rabbit(100009393) eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
naked mole-rat(101717780) eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
domestic guinea pig(100723483) eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003907 Rosetta Predictions human pricing
NM_138866 Rosetta Predictions rat pricing
NM_172265 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068127 predicted 1175
2 SASI_Hs02_00336535 predicted 647
3 SASI_Hs01_00068129 predicted 982
4 SASI_Hs02_00336536 predicted 985
5 SASI_Hs01_00068131 predicted 1151
6 SASI_Hs01_00068132 predicted 567
7 SASI_Hs01_00068134 predicted 2431
8 SASI_Hs02_00336537 predicted 890
9 SASI_Hs01_00068135 predicted 705
10 SASI_Hs01_00068136 predicted 2502
11 SASI_Hs01_00068128 predicted 1277
12 SASI_Hs01_00068130 predicted 1941
13 SASI_Hs01_00068133 predicted 2337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114786 predicted 698
2 SASI_Rn01_00114787 predicted 519
3 SASI_Rn01_00114788 predicted 1763
4 SASI_Rn01_00114789 predicted 807
5 SASI_Rn01_00114790 predicted 2270
6 SASI_Rn01_00114791 predicted 1403
7 SASI_Rn01_00114792 predicted 854
8 SASI_Rn01_00114794 predicted 2282
9 SASI_Rn01_00114795 predicted 224
10 SASI_Rn02_00268277 predicted 1492
11 SASI_Rn01_00114793 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052499 predicted 1238
2 SASI_Mm01_00052500 predicted 1628
3 SASI_Mm01_00052501 predicted 2052
4 SASI_Mm01_00052502 predicted 1468
5 SASI_Mm01_00052503 predicted 583
6 SASI_Mm01_00052504 predicted 1827
7 SASI_Mm01_00052505 predicted 374
8 SASI_Mm01_00052506 predicted 1003
9 SASI_Mm01_00052507 predicted 460
10 SASI_Mm01_00052508 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003907
VALIDATED
EIF2B5 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003907.1-2342s1c1
Sequence:CCGGGCTGGAACTACAGTATTCTTTCTCGAGAAAGAATACTGTAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003907.1-390s1c1
Sequence:CCGGCCTACATCTCTCAATGTGGTTCTCGAGAACCACATTGAGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003907.1-916s1c1
Sequence:CCGGTGCACGTAACAGCTAAGGAATCTCGAGATTCCTTAGCTGTTACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003907.1-2108s1c1
Sequence:CCGGCCAAAGAGATACAACTGACAACTCGAGTTGTCAGTTGTATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003907.1-917s1c1
Sequence:CCGGGCACGTAACAGCTAAGGAATACTCGAGTATTCCTTAGCTGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-704s21c1
Sequence:CCGGCCTACATCTCTCAATGTGGTTCTCGAGAACCACATTGAGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-2422s21c1
Sequence:CCGGCCAAAGAGATACAACTGACAACTCGAGTTGTCAGTTGTATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003907.2-2656s21c1
Sequence:CCGGGCTGGAACTACAGTATTCTTTCTCGAGAAAGAATACTGTAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-1230s21c1
Sequence:CCGGTGCACGTAACAGCTAAGGAATCTCGAGATTCCTTAGCTGTTACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003907
VALIDATED
EIF2B5 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003907.1-2342s1c1
Sequence:CCGGGCTGGAACTACAGTATTCTTTCTCGAGAAAGAATACTGTAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003907.1-390s1c1
Sequence:CCGGCCTACATCTCTCAATGTGGTTCTCGAGAACCACATTGAGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003907.1-916s1c1
Sequence:CCGGTGCACGTAACAGCTAAGGAATCTCGAGATTCCTTAGCTGTTACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003907.1-2108s1c1
Sequence:CCGGCCAAAGAGATACAACTGACAACTCGAGTTGTCAGTTGTATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003907.1-917s1c1
Sequence:CCGGGCACGTAACAGCTAAGGAATACTCGAGTATTCCTTAGCTGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-704s21c1
Sequence:CCGGCCTACATCTCTCAATGTGGTTCTCGAGAACCACATTGAGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-2422s21c1
Sequence:CCGGCCAAAGAGATACAACTGACAACTCGAGTTGTCAGTTGTATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003907.2-2656s21c1
Sequence:CCGGGCTGGAACTACAGTATTCTTTCTCGAGAAAGAATACTGTAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-1230s21c1
Sequence:CCGGTGCACGTAACAGCTAAGGAATCTCGAGATTCCTTAGCTGTTACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003907
VALIDATED
EIF2B5 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003907.1-2342s1c1
Sequence:CCGGGCTGGAACTACAGTATTCTTTCTCGAGAAAGAATACTGTAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003907.1-390s1c1
Sequence:CCGGCCTACATCTCTCAATGTGGTTCTCGAGAACCACATTGAGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003907.1-916s1c1
Sequence:CCGGTGCACGTAACAGCTAAGGAATCTCGAGATTCCTTAGCTGTTACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003907.1-2108s1c1
Sequence:CCGGCCAAAGAGATACAACTGACAACTCGAGTTGTCAGTTGTATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003907.1-917s1c1
Sequence:CCGGGCACGTAACAGCTAAGGAATACTCGAGTATTCCTTAGCTGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-704s21c1
Sequence:CCGGCCTACATCTCTCAATGTGGTTCTCGAGAACCACATTGAGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-2422s21c1
Sequence:CCGGCCAAAGAGATACAACTGACAACTCGAGTTGTCAGTTGTATCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003907.2-2656s21c1
Sequence:CCGGGCTGGAACTACAGTATTCTTTCTCGAGAAAGAATACTGTAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003907.2-1230s21c1
Sequence:CCGGTGCACGTAACAGCTAAGGAATCTCGAGATTCCTTAGCTGTTACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172265
VALIDATED
EIF2B5 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172265.1-2341s1c1
Sequence:CCGGGCAGACTGAGAATTATTGGAACTCGAGTTCCAATAATTCTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-1348s1c1
Sequence:CCGGGCGAGTCAAACTGAAGCCATACTCGAGTATGGCTTCAGTTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172265.1-519s1c1
Sequence:CCGGGCTCTGACTTTCTCTTGATATCTCGAGATATCAAGAGAAAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-2222s1c1
Sequence:CCGGGCAGAAGAAGAGTCATCCGAACTCGAGTTCGGATGACTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-952s1c1
Sequence:CCGGGCATGTGACAACTAGGGAATACTCGAGTATTCCCTAGTTGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-952s21c1
Sequence:CCGGGCATGTGACAACTAGGGAATACTCGAGTATTCCCTAGTTGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172265.1-2341s21c1
Sequence:CCGGGCAGACTGAGAATTATTGGAACTCGAGTTCCAATAATTCTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-519s21c1
Sequence:CCGGGCTCTGACTTTCTCTTGATATCTCGAGATATCAAGAGAAAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-1348s21c1
Sequence:CCGGGCGAGTCAAACTGAAGCCATACTCGAGTATGGCTTCAGTTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172265
VALIDATED
EIF2B5 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172265.1-2341s1c1
Sequence:CCGGGCAGACTGAGAATTATTGGAACTCGAGTTCCAATAATTCTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-1348s1c1
Sequence:CCGGGCGAGTCAAACTGAAGCCATACTCGAGTATGGCTTCAGTTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172265.1-519s1c1
Sequence:CCGGGCTCTGACTTTCTCTTGATATCTCGAGATATCAAGAGAAAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-2222s1c1
Sequence:CCGGGCAGAAGAAGAGTCATCCGAACTCGAGTTCGGATGACTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-952s1c1
Sequence:CCGGGCATGTGACAACTAGGGAATACTCGAGTATTCCCTAGTTGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-952s21c1
Sequence:CCGGGCATGTGACAACTAGGGAATACTCGAGTATTCCCTAGTTGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172265.1-2341s21c1
Sequence:CCGGGCAGACTGAGAATTATTGGAACTCGAGTTCCAATAATTCTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-519s21c1
Sequence:CCGGGCTCTGACTTTCTCTTGATATCTCGAGATATCAAGAGAAAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-1348s21c1
Sequence:CCGGGCGAGTCAAACTGAAGCCATACTCGAGTATGGCTTCAGTTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172265
VALIDATED
EIF2B5 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172265.1-2341s1c1
Sequence:CCGGGCAGACTGAGAATTATTGGAACTCGAGTTCCAATAATTCTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-1348s1c1
Sequence:CCGGGCGAGTCAAACTGAAGCCATACTCGAGTATGGCTTCAGTTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172265.1-519s1c1
Sequence:CCGGGCTCTGACTTTCTCTTGATATCTCGAGATATCAAGAGAAAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-2222s1c1
Sequence:CCGGGCAGAAGAAGAGTCATCCGAACTCGAGTTCGGATGACTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172265.1-952s1c1
Sequence:CCGGGCATGTGACAACTAGGGAATACTCGAGTATTCCCTAGTTGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-952s21c1
Sequence:CCGGGCATGTGACAACTAGGGAATACTCGAGTATTCCCTAGTTGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172265.1-2341s21c1
Sequence:CCGGGCAGACTGAGAATTATTGGAACTCGAGTTCCAATAATTCTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-519s21c1
Sequence:CCGGGCTCTGACTTTCTCTTGATATCTCGAGATATCAAGAGAAAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172265.1-1348s21c1
Sequence:CCGGGCGAGTCAAACTGAAGCCATACTCGAGTATGGCTTCAGTTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks