EMAIL THIS PAGE TO A FRIEND

EIF2D

eukaryotic translation initiation factor 2D

74 Gene Product Result for
Synonyms: HCA56 LGTN
Gene ID:
Human(1939) Summary: This gene encodes a translation initiation factor involved in the recruitment and delivery of aminoacyl-tRNAs to the P-site of the eukaryotic ribosome in a GTP-independent manner. This gene was previously referred to as ligatin, but is now known to localize to the cytoplasm and localize and function with translation factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(16865) eukaryotic translation initiation factor 2D
Rat(498225) eukaryotic translation initiation factor 2D
sheep(101117434) eukaryotic translation initiation factor 2D
Domestic Rabbit(100345187) eukaryotic translation initiation factor 2D
domestic guinea pig(100715720) eukaryotic translation initiation factor 2D
naked mole-rat(101696463) eukaryotic translation initiation factor 2D
Zebrafish(394137) eukaryotic translation initiation factor 2D
cow(511844) eukaryotic translation initiation factor 2D
Horse(100055423) eukaryotic translation initiation factor 2D
domestic cat(101089736) eukaryotic translation initiation factor 2D
chicken(419845) eukaryotic translation initiation factor 2D
dog(478951) eukaryotic translation initiation factor 2D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006893 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006893 Rosetta Predictions human pricing
NM_001017489 Rosetta Predictions rat pricing
NM_010709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072800 predicted 1503
2 SASI_Hs01_00072801 predicted 1690
3 SASI_Hs01_00072802 predicted 1637
4 SASI_Hs01_00072803 predicted 1252
5 SASI_Hs01_00072804 predicted 342
6 SASI_Hs02_00342566 predicted 1033
7 SASI_Hs01_00072806 predicted 784
8 SASI_Hs01_00072807 predicted 312
9 SASI_Hs01_00072808 predicted 1001
10 SASI_Hs02_00342567 predicted 1071
11 SASI_Hs01_00072805 predicted 457
12 SASI_Hs01_00072809 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202301 predicted 404
2 SASI_Rn01_00056808 predicted 299
3 SASI_Rn02_00202302 predicted 1071
4 SASI_Rn01_00056810 predicted 937
5 SASI_Rn02_00202303 predicted 347
6 SASI_Rn02_00202304 predicted 861
7 SASI_Rn01_00056812 predicted 471
8 SASI_Rn01_00056813 predicted 976
9 SASI_Rn02_00202305 predicted 464
10 SASI_Rn02_00202306 predicted 773
11 SASI_Rn01_00056804 predicted 1633
12 SASI_Rn01_00056805 predicted 1650
13 SASI_Rn01_00056806 predicted 1696
14 SASI_Rn01_00056807 predicted 1605
15 SASI_Rn01_00056809 predicted 1285
16 SASI_Rn01_00056811 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184383 predicted 232
2 SASI_Mm01_00184384 predicted 1217
3 SASI_Mm01_00184386 predicted 1008
4 SASI_Mm01_00184387 predicted 1385
5 SASI_Mm02_00319168 predicted 280
6 SASI_Mm02_00319169 predicted 270
7 SASI_Mm01_00184388 predicted 1852
8 SASI_Mm01_00184389 predicted 566
9 SASI_Mm01_00184390 predicted 1394
10 SASI_Mm01_00184391 predicted 400
11 SASI_Mm01_00184385 predicted 241
12 SASI_Mm01_00184392 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010709
VALIDATED
EIF2D MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-285s21c1
Sequence:CCGGGTGAAGTTGTATGTTCACAAACTCGAGTTTGTGAACATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1503s21c1
Sequence:CCGGCCTGCCTACCAAGTAACATTTCTCGAGAAATGTTACTTGGTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1328s21c1
Sequence:CCGGCCGAAAGATCATCACGGACTACTCGAGTAGTCCGTGATGATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1536s21c1
Sequence:CCGGCCCATTCTAAAGAAAGGGAAACTCGAGTTTCCCTTTCTTTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010709.1-1869s1c1
Sequence:CCGGGCCTGTATTGCAGATGGGAAACTCGAGTTTCCCATCTGCAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1537s1c1
Sequence:CCGGCCCATTCTAAAGAAAGGGAAACTCGAGTTTCCCTTTCTTTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-286s1c1
Sequence:CCGGGTGAAGTTGTATGTTCACAAACTCGAGTTTGTGAACATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1329s1c1
Sequence:CCGGCCGAAAGATCATCACGGACTACTCGAGTAGTCCGTGATGATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1504s1c1
Sequence:CCGGCCTGCCTACCAAGTAACATTTCTCGAGAAATGTTACTTGGTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010709
VALIDATED
EIF2D MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-285s21c1
Sequence:CCGGGTGAAGTTGTATGTTCACAAACTCGAGTTTGTGAACATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1503s21c1
Sequence:CCGGCCTGCCTACCAAGTAACATTTCTCGAGAAATGTTACTTGGTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1328s21c1
Sequence:CCGGCCGAAAGATCATCACGGACTACTCGAGTAGTCCGTGATGATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1536s21c1
Sequence:CCGGCCCATTCTAAAGAAAGGGAAACTCGAGTTTCCCTTTCTTTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010709.1-1869s1c1
Sequence:CCGGGCCTGTATTGCAGATGGGAAACTCGAGTTTCCCATCTGCAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1537s1c1
Sequence:CCGGCCCATTCTAAAGAAAGGGAAACTCGAGTTTCCCTTTCTTTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-286s1c1
Sequence:CCGGGTGAAGTTGTATGTTCACAAACTCGAGTTTGTGAACATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1329s1c1
Sequence:CCGGCCGAAAGATCATCACGGACTACTCGAGTAGTCCGTGATGATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1504s1c1
Sequence:CCGGCCTGCCTACCAAGTAACATTTCTCGAGAAATGTTACTTGGTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010709
VALIDATED
EIF2D MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-285s21c1
Sequence:CCGGGTGAAGTTGTATGTTCACAAACTCGAGTTTGTGAACATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1503s21c1
Sequence:CCGGCCTGCCTACCAAGTAACATTTCTCGAGAAATGTTACTTGGTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1328s21c1
Sequence:CCGGCCGAAAGATCATCACGGACTACTCGAGTAGTCCGTGATGATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010709.2-1536s21c1
Sequence:CCGGCCCATTCTAAAGAAAGGGAAACTCGAGTTTCCCTTTCTTTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010709.1-1869s1c1
Sequence:CCGGGCCTGTATTGCAGATGGGAAACTCGAGTTTCCCATCTGCAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1537s1c1
Sequence:CCGGCCCATTCTAAAGAAAGGGAAACTCGAGTTTCCCTTTCTTTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-286s1c1
Sequence:CCGGGTGAAGTTGTATGTTCACAAACTCGAGTTTGTGAACATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1329s1c1
Sequence:CCGGCCGAAAGATCATCACGGACTACTCGAGTAGTCCGTGATGATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010709.1-1504s1c1
Sequence:CCGGCCTGCCTACCAAGTAACATTTCTCGAGAAATGTTACTTGGTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006893
VALIDATED
EIF2D MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1692s21c1
Sequence:CCGGCTAGCACAAAGAGCGTCTAATCTCGAGATTAGACGCTCTTTGTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1439s21c1
Sequence:CCGGGGTCCGAACGATCGTCATTAACTCGAGTTAATGACGATCGTTCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1261s21c1
Sequence:CCGGGGATTACATCTTTCGTCATACCTCGAGGTATGACGAAAGATGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1179s21c1
Sequence:CCGGATGCAGCAGGAGCAGATTATACTCGAGTATAATCTGCTCCTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1119s21c1
Sequence:CCGGGGACGACAACTGGACATAAAGCTCGAGCTTTATGTCCAGTTGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-1604s1c1
Sequence:CCGGCCTAGCACAAAGAGCGTCTAACTCGAGTTAGACGCTCTTTGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-977s1c1
Sequence:CCGGCCCTTTACTCACCAGCACTTTCTCGAGAAAGTGCTGGTGAGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-273s1c1
Sequence:CCGGGTGAAGTTGTATGCTCACAAACTCGAGTTTGTGAGCATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006893.1-1364s1c1
Sequence:CCGGCGTCATTAACTACGCCAAGAACTCGAGTTCTTGGCGTAGTTAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-390s1c1
Sequence:CCGGCCTGATCTTCTGCCAACCTTTCTCGAGAAAGGTTGGCAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006893
VALIDATED
EIF2D MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1692s21c1
Sequence:CCGGCTAGCACAAAGAGCGTCTAATCTCGAGATTAGACGCTCTTTGTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1439s21c1
Sequence:CCGGGGTCCGAACGATCGTCATTAACTCGAGTTAATGACGATCGTTCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1261s21c1
Sequence:CCGGGGATTACATCTTTCGTCATACCTCGAGGTATGACGAAAGATGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1179s21c1
Sequence:CCGGATGCAGCAGGAGCAGATTATACTCGAGTATAATCTGCTCCTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1119s21c1
Sequence:CCGGGGACGACAACTGGACATAAAGCTCGAGCTTTATGTCCAGTTGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-1604s1c1
Sequence:CCGGCCTAGCACAAAGAGCGTCTAACTCGAGTTAGACGCTCTTTGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-977s1c1
Sequence:CCGGCCCTTTACTCACCAGCACTTTCTCGAGAAAGTGCTGGTGAGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-273s1c1
Sequence:CCGGGTGAAGTTGTATGCTCACAAACTCGAGTTTGTGAGCATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006893.1-1364s1c1
Sequence:CCGGCGTCATTAACTACGCCAAGAACTCGAGTTCTTGGCGTAGTTAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-390s1c1
Sequence:CCGGCCTGATCTTCTGCCAACCTTTCTCGAGAAAGGTTGGCAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006893
VALIDATED
EIF2D MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1692s21c1
Sequence:CCGGCTAGCACAAAGAGCGTCTAATCTCGAGATTAGACGCTCTTTGTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1439s21c1
Sequence:CCGGGGTCCGAACGATCGTCATTAACTCGAGTTAATGACGATCGTTCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1261s21c1
Sequence:CCGGGGATTACATCTTTCGTCATACCTCGAGGTATGACGAAAGATGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1179s21c1
Sequence:CCGGATGCAGCAGGAGCAGATTATACTCGAGTATAATCTGCTCCTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006893.2-1119s21c1
Sequence:CCGGGGACGACAACTGGACATAAAGCTCGAGCTTTATGTCCAGTTGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-1604s1c1
Sequence:CCGGCCTAGCACAAAGAGCGTCTAACTCGAGTTAGACGCTCTTTGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-977s1c1
Sequence:CCGGCCCTTTACTCACCAGCACTTTCTCGAGAAAGTGCTGGTGAGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-273s1c1
Sequence:CCGGGTGAAGTTGTATGCTCACAAACTCGAGTTTGTGAGCATACAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006893.1-1364s1c1
Sequence:CCGGCGTCATTAACTACGCCAAGAACTCGAGTTCTTGGCGTAGTTAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006893.1-390s1c1
Sequence:CCGGCCTGATCTTCTGCCAACCTTTCTCGAGAAAGGTTGGCAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks