EMAIL THIS PAGE TO A FRIEND

EIF2S1

eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa

117 Gene Product Result for
Synonyms: EIF-2 EIF-2A EIF-2alpha EIF2 EIF2A
UniProtKB ID: P05198
Gene ID:
Human(1965) Summary: The translation initiation factor EIF2 catalyzes the first regulated step of protein synthesis initiation, promoting the binding of the initiator tRNA to 40S ribosomal subunits. Binding occurs as a ternary complex of methionyl-tRNA, EIF2, and GTP. EIF2 is composed of 3 nonidentical subunits, the 36-kD EIF2-alpha subunit (EIF2S1), the 38-kD EIF2-beta subunit (EIF2S2; MIM 603908), and the 52-kD EIF2-gamma subunit (EIF2S3; MIM 300161). The rate of formation of the ternary complex is modulated by the phosphorylation state of EIF2-alpha (Ernst et al., 1987 [PubMed 2948954]
Mouse(13665) eukaryotic translation initiation factor 2, subunit 1 alpha
Rat(54318) eukaryotic translation initiation factor 2, subunit 1 alpha
domestic guinea pig(100716377) eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
naked mole-rat(101723170) eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Goat(100861133) eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
sheep(101113414) eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
chicken(423279) eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
dog(480361) eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
cow(327694) eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
domestic cat(101091455) eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500729 Anti-EIF2 α antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
E0157 Anti-eIF2α antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300523 Anti-EIF2S1 (Ab-51) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
AV40508 Anti-EIF2S1 antibody produced in rabbit IgG fraction of antiserum horse, rat, canine, guinea pig, rabbit, bovine, zebrafish, human, mouse
immunohistochemistry, western blot pricing
HPA064885 Anti-EIF2S1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104544 Anti-EIF2S1, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, human, rat, rabbit, canine, guinea pig, mouse, horse
western blot pricing
SAB4504388 Anti-phospho-eIF2 α (pSer51) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4300266 Anti-phospho-EIF2S1 (pSer49) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300221 Anti-phospho-EIF2S1 (pSer51) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0001965M1 Monoclonal Anti-EIF2S1 antibody produced in mouse clone 3H12-C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4100157 Monoclonal Anti-EIF2S1 antibody produced in mouse clone EIF2S1-A125, culture supernatant human
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0151 Cell-Based ELISA for detecting phospho-EGFR in cultured cell lines, 96 assays human pricing
RAB0152 Cell-Based ELISA for detecting phospho-EGFR (pTyr1068) in cultured cell lines 96 assays human pricing
RAB0155 Cell-Based ELISA for detecting phospho-EGFR (pTyr845) in cultured cell lines 96 assays human pricing
RAB0157 Cell-Based ELISA for detecting phospho-EGFR (pTyr992) in cultured cell lines 96 assays human pricing
RAB0159 Cell-Based phospho-EGFR ELISA Sampler Kit for detecting phospho-egfr(pTyr845), phospho-egfr(pTyr992), phospho-egfr(pTyr1068) and phospho-egfr in cultured cell lines human pricing
RAB0160 Human EGFR / ErbB1 ELISA Kit for serum, plasma, cell culture supernatants and urine human pricing
RAB0162 Phospho-EGFR (pSer1070) and pan-EGFR ELISA Kit for detection of human phospho-egfr (pSer1070) and pan-egfr in cell and tissue lysates human pricing
RAB0161 Phospho-EGFR (pSer1070) ELISA Kit for detection of human, mouse or rat phospho-egfr (pSer1070) in cell and tissue lysates human pricing
RAB0164 Phospho-EGFR (pTyr1045) and pan-EGFR ELISA Kit for detection of human phospho-egfr (pTyr1045) and pan-egfr in cell and tissue lysates human pricing
RAB0163 Phospho-EGFR (pTyr1045) ELISA Kit for detection of human phospho-egfr (pTyr1045) in cell and tissue lysates human pricing
RAB0166 Phospho-EGFR (pTyr1068) and pan-EGFR ELISA Kit for detection of human phospho-egfr (pTyr1068) and pan-egfr in cell and tissue lysates human pricing
RAB0165 Phospho-EGFR (pTyr1068) ELISA Kit for detection of human phospho-egfr (pTyr1068) in cell and tissue lysates human pricing
RAB0168 Phospho-EGFR (pTyr1086) and pan-EGFR ELISA Kit for detection of human phospho-egfr (pTyr1086) and pan-egfr in cell and tissue lysates human pricing
RAB0167 Phospho-EGFR (pTyr1086) ELISA Kit for detection of human phospho-egfr (pTyr1086) in cell and tissue lysates human pricing
RAB0170 Phospho-EGFR (pTyr992) and pan-EGFR ELISA Kit for detection of human phospho-egfr (pTyr992) and pan-egfr in cell and tissue lysates human pricing
RAB0169 Phospho-EGFR (pTyr992) ELISA Kit for detection of human phospho-egfr (pTyr992) in cell and tissue lysates human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004094 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004094 Rosetta Predictions human pricing
NM_019356 Rosetta Predictions rat pricing
NM_026114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155629 predicted 226
2 SASI_Hs01_00155631 predicted 804
3 SASI_Hs01_00155632 predicted 349
4 SASI_Hs01_00155633 predicted 890
5 SASI_Hs01_00155634 predicted 327
6 SASI_Hs01_00155635 predicted 1132
7 SASI_Hs01_00155636 predicted 1093
8 SASI_Hs01_00155637 predicted 1095
9 SASI_Hs02_00336901 predicted 874
10 SASI_Hs02_00336902 predicted 889
11 SASI_Hs01_00155630 predicted 777
12 SASI_Hs01_00155638 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054179 predicted 982
2 SASI_Rn01_00054180 predicted 858
3 SASI_Rn02_00262365 predicted 849
4 SASI_Rn02_00262366 predicted 56
5 SASI_Rn01_00054171 predicted 231
6 SASI_Rn01_00054172 predicted 698
7 SASI_Rn01_00054173 predicted 555
8 SASI_Rn01_00054174 predicted 962
9 SASI_Rn01_00054175 predicted 226
10 SASI_Rn01_00054176 predicted 596
11 SASI_Rn01_00054177 predicted 233
12 SASI_Rn01_00054178 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063389 predicted 208
2 SASI_Mm01_00063390 predicted 200
3 SASI_Mm01_00063391 predicted 211
4 SASI_Mm01_00063392 predicted 621
5 SASI_Mm01_00063393 predicted 582
6 SASI_Mm01_00063395 predicted 629
7 SASI_Mm01_00063396 predicted 777
8 SASI_Mm01_00063397 predicted 940
9 SASI_Mm02_00329692 predicted 323
10 SASI_Mm02_00329693 predicted 1098
11 SASI_Mm01_00063388 predicted 974
12 SASI_Mm01_00063394 predicted 644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004094
VALIDATED
EIF2S1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.3-556s1c1
Sequence:CCGGGCAGTCTCAGACCCATCTATTCTCGAGAATAGATGGGTCTGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004094.3-897s1c1
Sequence:CCGGCAATGTTCAAATGGAGCCCAACTCGAGTTGGGCTCCATTTGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-199s1c1
Sequence:CCGGCTGGAATACAACAACATTGAACTCGAGTTCAATGTTGTTGTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-253s1c1
Sequence:CCGGCGTATCCGTTCTATCAACAAACTCGAGTTTGTTGATAGAACGGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-2643s1c1
Sequence:CCGGGCCAGAGAATAGATCAGTATTCTCGAGAATACTGATCTATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004094.3-2204s1c1
Sequence:CCGGGCAGGTAGTTTGTACCATTTACTCGAGTAAATGGTACAAACTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004094.3-665s1c1
Sequence:CCGGGAGCAGATATTGAAGTGGCTTCTCGAGAAGCCACTTCAATATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-607s21c1
Sequence:CCGGGCAGTCTCAGACCCATCTATTCTCGAGAATAGATGGGTCTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004094.4-2766s21c1
Sequence:CCGGGCCAGAGAATAGATCAGTATTCTCGAGAATACTGATCTATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-304s21c1
Sequence:CCGGCGTATCCGTTCTATCAACAAACTCGAGTTTGTTGATAGAACGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-810s1c1
Sequence:CCGGGCCCATTAAGATTAATCTAATCTCGAGATTAGATTAATCTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-653s1c1
Sequence:CCGGATGAACGGGAAGTACTCATTACTCGAGTAATGAGTACTTCCCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-580s1c1
Sequence:CCGGTATGGTGCCTATGATGCATTTCTCGAGAAATGCATCATAGGCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-580s21c1
Sequence:CCGGTATGGTGCCTATGATGCATTTCTCGAGAAATGCATCATAGGCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-250s21c1
Sequence:CCGGCTGGAATACAACAACATTGAACTCGAGTTCAATGTTGTTGTATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004094
VALIDATED
EIF2S1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.3-556s1c1
Sequence:CCGGGCAGTCTCAGACCCATCTATTCTCGAGAATAGATGGGTCTGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004094.3-897s1c1
Sequence:CCGGCAATGTTCAAATGGAGCCCAACTCGAGTTGGGCTCCATTTGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-199s1c1
Sequence:CCGGCTGGAATACAACAACATTGAACTCGAGTTCAATGTTGTTGTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-253s1c1
Sequence:CCGGCGTATCCGTTCTATCAACAAACTCGAGTTTGTTGATAGAACGGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-2643s1c1
Sequence:CCGGGCCAGAGAATAGATCAGTATTCTCGAGAATACTGATCTATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004094.3-2204s1c1
Sequence:CCGGGCAGGTAGTTTGTACCATTTACTCGAGTAAATGGTACAAACTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004094.3-665s1c1
Sequence:CCGGGAGCAGATATTGAAGTGGCTTCTCGAGAAGCCACTTCAATATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-607s21c1
Sequence:CCGGGCAGTCTCAGACCCATCTATTCTCGAGAATAGATGGGTCTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004094.4-2766s21c1
Sequence:CCGGGCCAGAGAATAGATCAGTATTCTCGAGAATACTGATCTATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-304s21c1
Sequence:CCGGCGTATCCGTTCTATCAACAAACTCGAGTTTGTTGATAGAACGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-810s1c1
Sequence:CCGGGCCCATTAAGATTAATCTAATCTCGAGATTAGATTAATCTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-653s1c1
Sequence:CCGGATGAACGGGAAGTACTCATTACTCGAGTAATGAGTACTTCCCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-580s1c1
Sequence:CCGGTATGGTGCCTATGATGCATTTCTCGAGAAATGCATCATAGGCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-580s21c1
Sequence:CCGGTATGGTGCCTATGATGCATTTCTCGAGAAATGCATCATAGGCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-250s21c1
Sequence:CCGGCTGGAATACAACAACATTGAACTCGAGTTCAATGTTGTTGTATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004094
VALIDATED
EIF2S1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.3-556s1c1
Sequence:CCGGGCAGTCTCAGACCCATCTATTCTCGAGAATAGATGGGTCTGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004094.3-897s1c1
Sequence:CCGGCAATGTTCAAATGGAGCCCAACTCGAGTTGGGCTCCATTTGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-199s1c1
Sequence:CCGGCTGGAATACAACAACATTGAACTCGAGTTCAATGTTGTTGTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-253s1c1
Sequence:CCGGCGTATCCGTTCTATCAACAAACTCGAGTTTGTTGATAGAACGGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004094.3-2643s1c1
Sequence:CCGGGCCAGAGAATAGATCAGTATTCTCGAGAATACTGATCTATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004094.3-2204s1c1
Sequence:CCGGGCAGGTAGTTTGTACCATTTACTCGAGTAAATGGTACAAACTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004094.3-665s1c1
Sequence:CCGGGAGCAGATATTGAAGTGGCTTCTCGAGAAGCCACTTCAATATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-607s21c1
Sequence:CCGGGCAGTCTCAGACCCATCTATTCTCGAGAATAGATGGGTCTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004094.4-2766s21c1
Sequence:CCGGGCCAGAGAATAGATCAGTATTCTCGAGAATACTGATCTATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-304s21c1
Sequence:CCGGCGTATCCGTTCTATCAACAAACTCGAGTTTGTTGATAGAACGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-810s1c1
Sequence:CCGGGCCCATTAAGATTAATCTAATCTCGAGATTAGATTAATCTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-653s1c1
Sequence:CCGGATGAACGGGAAGTACTCATTACTCGAGTAATGAGTACTTCCCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004094.4-580s1c1
Sequence:CCGGTATGGTGCCTATGATGCATTTCTCGAGAAATGCATCATAGGCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-580s21c1
Sequence:CCGGTATGGTGCCTATGATGCATTTCTCGAGAAATGCATCATAGGCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004094.4-250s21c1
Sequence:CCGGCTGGAATACAACAACATTGAACTCGAGTTCAATGTTGTTGTATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026114
EIF2S1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026114.1-1418s1c1
Sequence:CCGGCCAAACACAAACAATCCCAATCTCGAGATTGGGATTGTTTGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-423s1c1
Sequence:CCGGGCAATCAAATGTGAGGACAAACTCGAGTTTGTCCTCACATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-617s1c1
Sequence:CCGGCCCATCTATCTTGGATAGTTTCTCGAGAAACTATCCAAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-308s1c1
Sequence:CCGGCCGTTCTATAAACAAACTGATCTCGAGATCAGTTTGTTTATAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-422s1c1
Sequence:CCGGAGCAATCAAATGTGAGGACAACTCGAGTTGTCCTCACATTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026114.3-1388s21c1
Sequence:CCGGCCAAACACAAACAATCCCAATCTCGAGATTGGGATTGTTTGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-278s21c1
Sequence:CCGGCCGTTCTATAAACAAACTGATCTCGAGATCAGTTTGTTTATAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-393s21c1
Sequence:CCGGGCAATCAAATGTGAGGACAAACTCGAGTTTGTCCTCACATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-587s21c1
Sequence:CCGGCCCATCTATCTTGGATAGTTTCTCGAGAAACTATCCAAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026114
EIF2S1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026114.1-1418s1c1
Sequence:CCGGCCAAACACAAACAATCCCAATCTCGAGATTGGGATTGTTTGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-423s1c1
Sequence:CCGGGCAATCAAATGTGAGGACAAACTCGAGTTTGTCCTCACATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-617s1c1
Sequence:CCGGCCCATCTATCTTGGATAGTTTCTCGAGAAACTATCCAAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-308s1c1
Sequence:CCGGCCGTTCTATAAACAAACTGATCTCGAGATCAGTTTGTTTATAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-422s1c1
Sequence:CCGGAGCAATCAAATGTGAGGACAACTCGAGTTGTCCTCACATTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026114.3-1388s21c1
Sequence:CCGGCCAAACACAAACAATCCCAATCTCGAGATTGGGATTGTTTGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-278s21c1
Sequence:CCGGCCGTTCTATAAACAAACTGATCTCGAGATCAGTTTGTTTATAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-393s21c1
Sequence:CCGGGCAATCAAATGTGAGGACAAACTCGAGTTTGTCCTCACATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-587s21c1
Sequence:CCGGCCCATCTATCTTGGATAGTTTCTCGAGAAACTATCCAAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026114
EIF2S1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026114.1-1418s1c1
Sequence:CCGGCCAAACACAAACAATCCCAATCTCGAGATTGGGATTGTTTGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-423s1c1
Sequence:CCGGGCAATCAAATGTGAGGACAAACTCGAGTTTGTCCTCACATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-617s1c1
Sequence:CCGGCCCATCTATCTTGGATAGTTTCTCGAGAAACTATCCAAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-308s1c1
Sequence:CCGGCCGTTCTATAAACAAACTGATCTCGAGATCAGTTTGTTTATAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026114.1-422s1c1
Sequence:CCGGAGCAATCAAATGTGAGGACAACTCGAGTTGTCCTCACATTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026114.3-1388s21c1
Sequence:CCGGCCAAACACAAACAATCCCAATCTCGAGATTGGGATTGTTTGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-278s21c1
Sequence:CCGGCCGTTCTATAAACAAACTGATCTCGAGATCAGTTTGTTTATAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-393s21c1
Sequence:CCGGGCAATCAAATGTGAGGACAAACTCGAGTTTGTCCTCACATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026114.3-587s21c1
Sequence:CCGGCCCATCTATCTTGGATAGTTTCTCGAGAAACTATCCAAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks