EMAIL THIS PAGE TO A FRIEND

EIF2S2

eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa

85 Gene Product Result for
Synonyms: EIF2 EIF2B EIF2beta PPP1R67 eIF-2-beta
UniProtKB ID: P20042, Q9BVU0, Q9UJE4
Gene ID:
Human(8894) Summary: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. [provided by RefSeq, Jul 2008]
Mouse(67204) eukaryotic translation initiation factor 2, subunit 2 (beta)
Rat(296302) eukaryotic translation initiation factor 2, subunit 2 beta
Zebrafish(324365) eukaryotic translation initiation factor 2, subunit 2 beta
chicken(395295) eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
dog(477197) eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
domestic cat(101097715) eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
cow(520094) eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
sheep(101111733) eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Domestic Rabbit(100009285) eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
domestic guinea pig(100718386) eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40501 Anti-EIF2S2 (AB1) antibody produced in rabbit affinity isolated antibody human, rat, horse, rabbit, rabbit, guinea pig, bovine, mouse
western blot pricing
AV40502 Anti-EIF2S2 (AB2) antibody produced in rabbit affinity isolated antibody horse, rabbit, human, guinea pig, bovine, rat, mouse, rabbit
western blot pricing
HPA041332 Anti-EIF2S2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2702012 Anti-EIF2S2 antibody produced in rabbit mouse, rat, human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702092 Anti-EIF2S2 antibody produced in rabbit human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
HPA041262 Anti-EIF2S2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1402439 Monoclonal Anti-EIF2S2, (N-terminal) antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003908 Rosetta Predictions human pricing
NM_199380 Rosetta Predictions rat pricing
NM_026030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205442 predicted 638
2 SASI_Hs01_00205441 predicted 673
3 SASI_Hs01_00205445 predicted 1237
4 SASI_Hs01_00205446 predicted 834
5 SASI_Hs02_00336538 predicted 1087
6 SASI_Hs01_00205447 predicted 989
7 SASI_Hs01_00205448 predicted 987
8 SASI_Hs01_00205449 predicted 864
9 SASI_Hs01_00205450 predicted 1057
10 SASI_Hs02_00336539 predicted 1155
11 SASI_Hs01_00205443 predicted 705
12 SASI_Hs01_00205444 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063785 predicted 1063
2 SASI_Rn01_00063786 predicted 778
3 SASI_Rn01_00063787 predicted 1000
4 SASI_Rn01_00063788 predicted 1113
5 SASI_Rn01_00063789 predicted 761
6 SASI_Rn01_00063790 predicted 1183
7 SASI_Rn01_00063791 predicted 1147
8 SASI_Rn01_00063792 predicted 984
9 SASI_Rn01_00063793 predicted 978
10 SASI_Rn01_00063794 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329501 predicted 955
2 SASI_Mm01_00063049 predicted 1002
3 SASI_Mm01_00063052 predicted 873
4 SASI_Mm02_00329502 predicted 854
5 SASI_Mm02_00329503 predicted 1478
6 SASI_Mm02_00329504 predicted 1007
7 SASI_Mm02_00329505 predicted 1191
8 SASI_Mm01_00063047 predicted 1361
9 SASI_Mm01_00063048 predicted 1334
10 SASI_Mm01_00063050 predicted 1227
11 SASI_Mm01_00063045 predicted 1365
12 SASI_Mm01_00063046 predicted 773
13 SASI_Mm01_00063051 predicted 966
14 SASI_Mm01_00063053 predicted 1139
15 SASI_Mm01_00063054 predicted 900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003908
VALIDATED
EIF2S2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-675s21c1
Sequence:CCGGGCTCAGAAAGAGACTACACATCTCGAGATGTGTAGTCTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-1059s21c1
Sequence:CCGGTCTATTTCCTACAGTGCGAAACTCGAGTTTCGCACTGTAGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-1074s21c1
Sequence:CCGGGCGAAACTTGTCATTCTAGATCTCGAGATCTAGAATGACAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-866s21c1
Sequence:CCGGCCCAAACATCTCCTTGCATTTCTCGAGAAATGCAAGGAGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003908.3-1234s21c1
Sequence:CCGGGAGTGGATATACCGTTGTATTCTCGAGAATACAACGGTATATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1203s1c1
Sequence:CCGGGAGTGGATATACCGTTGTATTCTCGAGAATACAACGGTATATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-835s1c1
Sequence:CCGGCCCAAACATCTCCTTGCATTTCTCGAGAAATGCAAGGAGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1043s1c1
Sequence:CCGGGCGAAACTTGTCATTCTAGATCTCGAGATCTAGAATGACAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1028s1c1
Sequence:CCGGTCTATTTCCTACAGTGCGAAACTCGAGTTTCGCACTGTAGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003908.2-644s1c1
Sequence:CCGGGCTCAGAAAGAGACTACACATCTCGAGATGTGTAGTCTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003908
VALIDATED
EIF2S2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-675s21c1
Sequence:CCGGGCTCAGAAAGAGACTACACATCTCGAGATGTGTAGTCTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-1059s21c1
Sequence:CCGGTCTATTTCCTACAGTGCGAAACTCGAGTTTCGCACTGTAGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-1074s21c1
Sequence:CCGGGCGAAACTTGTCATTCTAGATCTCGAGATCTAGAATGACAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-866s21c1
Sequence:CCGGCCCAAACATCTCCTTGCATTTCTCGAGAAATGCAAGGAGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003908.3-1234s21c1
Sequence:CCGGGAGTGGATATACCGTTGTATTCTCGAGAATACAACGGTATATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1203s1c1
Sequence:CCGGGAGTGGATATACCGTTGTATTCTCGAGAATACAACGGTATATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-835s1c1
Sequence:CCGGCCCAAACATCTCCTTGCATTTCTCGAGAAATGCAAGGAGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1043s1c1
Sequence:CCGGGCGAAACTTGTCATTCTAGATCTCGAGATCTAGAATGACAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1028s1c1
Sequence:CCGGTCTATTTCCTACAGTGCGAAACTCGAGTTTCGCACTGTAGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003908.2-644s1c1
Sequence:CCGGGCTCAGAAAGAGACTACACATCTCGAGATGTGTAGTCTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003908
VALIDATED
EIF2S2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-675s21c1
Sequence:CCGGGCTCAGAAAGAGACTACACATCTCGAGATGTGTAGTCTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-1059s21c1
Sequence:CCGGTCTATTTCCTACAGTGCGAAACTCGAGTTTCGCACTGTAGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-1074s21c1
Sequence:CCGGGCGAAACTTGTCATTCTAGATCTCGAGATCTAGAATGACAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003908.3-866s21c1
Sequence:CCGGCCCAAACATCTCCTTGCATTTCTCGAGAAATGCAAGGAGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003908.3-1234s21c1
Sequence:CCGGGAGTGGATATACCGTTGTATTCTCGAGAATACAACGGTATATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1203s1c1
Sequence:CCGGGAGTGGATATACCGTTGTATTCTCGAGAATACAACGGTATATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-835s1c1
Sequence:CCGGCCCAAACATCTCCTTGCATTTCTCGAGAAATGCAAGGAGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1043s1c1
Sequence:CCGGGCGAAACTTGTCATTCTAGATCTCGAGATCTAGAATGACAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003908.2-1028s1c1
Sequence:CCGGTCTATTTCCTACAGTGCGAAACTCGAGTTTCGCACTGTAGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003908.2-644s1c1
Sequence:CCGGGCTCAGAAAGAGACTACACATCTCGAGATGTGTAGTCTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026030
VALIDATED
EIF2S2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1658s21c1
Sequence:CCGGTGAAGCTACATGGCTAGAATACTCGAGTATTCTAGCCATGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1694s21c1
Sequence:CCGGGAAAGAGTGGTTGGAACATAACTCGAGTTATGTTCCAACCACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026030.2-398s21c1
Sequence:CCGGGCTTCTGATGACTTAGATGATCTCGAGATCATCTAAGTCATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026030.2-1080s21c1
Sequence:CCGGCCCGACTCTATTTCTTACAATCTCGAGATTGTAAGAAATAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1524s21c1
Sequence:CCGGCTACAATAAAGTGTTCGTTAACTCGAGTTAACGAACACTTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026030.1-2008s1c1
Sequence:CCGGCCCTGCTATCTTGACTATGTTCTCGAGAACATAGTCAAGATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026030.1-699s1c1
Sequence:CCGGCGTCCGAGTAGGAACCAAGAACTCGAGTTCTTGGTTCCTACTCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-430s1c1
Sequence:CCGGGACATTATGCTTGGCAACAAACTCGAGTTTGTTGCCAAGCATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-274s1c1
Sequence:CCGGGCTTCTGATGACTTAGATGATCTCGAGATCATCTAAGTCATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-956s1c1
Sequence:CCGGCCCGACTCTATTTCTTACAATCTCGAGATTGTAAGAAATAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026030
VALIDATED
EIF2S2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1658s21c1
Sequence:CCGGTGAAGCTACATGGCTAGAATACTCGAGTATTCTAGCCATGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1694s21c1
Sequence:CCGGGAAAGAGTGGTTGGAACATAACTCGAGTTATGTTCCAACCACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026030.2-398s21c1
Sequence:CCGGGCTTCTGATGACTTAGATGATCTCGAGATCATCTAAGTCATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026030.2-1080s21c1
Sequence:CCGGCCCGACTCTATTTCTTACAATCTCGAGATTGTAAGAAATAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1524s21c1
Sequence:CCGGCTACAATAAAGTGTTCGTTAACTCGAGTTAACGAACACTTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026030.1-2008s1c1
Sequence:CCGGCCCTGCTATCTTGACTATGTTCTCGAGAACATAGTCAAGATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026030.1-699s1c1
Sequence:CCGGCGTCCGAGTAGGAACCAAGAACTCGAGTTCTTGGTTCCTACTCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-430s1c1
Sequence:CCGGGACATTATGCTTGGCAACAAACTCGAGTTTGTTGCCAAGCATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-274s1c1
Sequence:CCGGGCTTCTGATGACTTAGATGATCTCGAGATCATCTAAGTCATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-956s1c1
Sequence:CCGGCCCGACTCTATTTCTTACAATCTCGAGATTGTAAGAAATAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026030
VALIDATED
EIF2S2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1658s21c1
Sequence:CCGGTGAAGCTACATGGCTAGAATACTCGAGTATTCTAGCCATGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1694s21c1
Sequence:CCGGGAAAGAGTGGTTGGAACATAACTCGAGTTATGTTCCAACCACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026030.2-398s21c1
Sequence:CCGGGCTTCTGATGACTTAGATGATCTCGAGATCATCTAAGTCATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026030.2-1080s21c1
Sequence:CCGGCCCGACTCTATTTCTTACAATCTCGAGATTGTAAGAAATAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026030.2-1524s21c1
Sequence:CCGGCTACAATAAAGTGTTCGTTAACTCGAGTTAACGAACACTTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026030.1-2008s1c1
Sequence:CCGGCCCTGCTATCTTGACTATGTTCTCGAGAACATAGTCAAGATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026030.1-699s1c1
Sequence:CCGGCGTCCGAGTAGGAACCAAGAACTCGAGTTCTTGGTTCCTACTCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-430s1c1
Sequence:CCGGGACATTATGCTTGGCAACAAACTCGAGTTTGTTGCCAAGCATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-274s1c1
Sequence:CCGGGCTTCTGATGACTTAGATGATCTCGAGATCATCTAAGTCATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026030.1-956s1c1
Sequence:CCGGCCCGACTCTATTTCTTACAATCTCGAGATTGTAAGAAATAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks