EMAIL THIS PAGE TO A FRIEND

EIF2S3

eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa

58 Gene Product Result for
Synonyms: EIF2 EIF2G EIF2gamma eIF-2gA
UniProtKB ID: P41091, B5BTZ4
Gene ID:
Human(1968) Summary: The protein encoded by this gene is the largest subunit of a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA(i) to the 40 S ribosomal subunit. [provided by RefSeq, Jan 2010]
Zebrafish(327341) eukaryotic translation initiation factor 2, subunit 3 gamma
chicken(418597) eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
domestic cat(101094652) eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
cow(512350) eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
dog(480866) eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
domestic guinea pig(100716347) eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
naked mole-rat(101697879) eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
sheep(101114675) eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
Domestic Rabbit(100344607) eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001415 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108091 MISSION® esiRNA esiRNA human EIF2S3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001415 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238775 predicted 1154
2 SASI_Hs01_00238777 predicted 398
3 SASI_Hs01_00238778 predicted 384
4 SASI_Hs01_00238779 predicted 487
5 SASI_Hs01_00238780 predicted 1123
6 SASI_Hs02_00331806 predicted 680
7 SASI_Hs01_00238781 predicted 1241
8 SASI_Hs01_00238782 predicted 1098
9 SASI_Hs02_00331807 predicted 685
10 SASI_Hs01_00238784 predicted 345
11 SASI_Hs01_00238776 predicted 1024
12 SASI_Hs01_00238783 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001415
EIF2S3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-1403s1c1
Sequence:CCGGGAGGAGTGACAATCAAGCCAACTCGAGTTGGCTTGATTGTCACTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1346s1c1
Sequence:CCGGCCCTTAGCCGAAGAGTTGAAACTCGAGTTTCAACTCTTCGGCTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-261s1c1
Sequence:CCGGGCTTGGATATGCTAATGCTAACTCGAGTTAGCATTAGCATATCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1215s1c1
Sequence:CCGGGTCTAAGAATGAAGTGCTCATCTCGAGATGAGCACTTCATTCTTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-782s1c1
Sequence:CCGGCCCGGCTTATTGTTATTAGATCTCGAGATCTAATAACAATAAGCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-646s1c1
Sequence:CCGGGCATTTGTCCAAGGTACAGTACTCGAGTACTGTACCTTGGACAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1225s1c1
Sequence:CCGGGAAGTGCTCATGGTGAACATACTCGAGTATGTTCACCATGAGCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-824s1c1
Sequence:CCGGGCTGTGAAGTTGATGACCTTACTCGAGTAAGGTCATCAACTTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-989s1c1
Sequence:CCGGCGGAGCATAATGATCTGCAATCTCGAGATTGCAGATCATTATGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-1435s21c1
Sequence:CCGGGACTGAAGAATACCAGTTAAACTCGAGTTTAACTGGTATTCTTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001415.3-1558s21c1
Sequence:CCGGGTAGGTAACGGTAAGGTTATTCTCGAGAATAACCTTACCGTTACCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-646s21c1
Sequence:CCGGGCATTTGTCCAAGGTACAGTACTCGAGTACTGTACCTTGGACAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-108s21c1
Sequence:CCGGGCCACTTTCACACGAAGTTATCTCGAGATAACTTCGTGTGAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-422s21c1
Sequence:CCGGACTGTCCTGGCCACGATATTTCTCGAGAAATATCGTGGCCAGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001415
EIF2S3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-1403s1c1
Sequence:CCGGGAGGAGTGACAATCAAGCCAACTCGAGTTGGCTTGATTGTCACTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1346s1c1
Sequence:CCGGCCCTTAGCCGAAGAGTTGAAACTCGAGTTTCAACTCTTCGGCTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-261s1c1
Sequence:CCGGGCTTGGATATGCTAATGCTAACTCGAGTTAGCATTAGCATATCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1215s1c1
Sequence:CCGGGTCTAAGAATGAAGTGCTCATCTCGAGATGAGCACTTCATTCTTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-782s1c1
Sequence:CCGGCCCGGCTTATTGTTATTAGATCTCGAGATCTAATAACAATAAGCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-646s1c1
Sequence:CCGGGCATTTGTCCAAGGTACAGTACTCGAGTACTGTACCTTGGACAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1225s1c1
Sequence:CCGGGAAGTGCTCATGGTGAACATACTCGAGTATGTTCACCATGAGCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-824s1c1
Sequence:CCGGGCTGTGAAGTTGATGACCTTACTCGAGTAAGGTCATCAACTTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-989s1c1
Sequence:CCGGCGGAGCATAATGATCTGCAATCTCGAGATTGCAGATCATTATGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-1435s21c1
Sequence:CCGGGACTGAAGAATACCAGTTAAACTCGAGTTTAACTGGTATTCTTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001415.3-1558s21c1
Sequence:CCGGGTAGGTAACGGTAAGGTTATTCTCGAGAATAACCTTACCGTTACCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-646s21c1
Sequence:CCGGGCATTTGTCCAAGGTACAGTACTCGAGTACTGTACCTTGGACAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-108s21c1
Sequence:CCGGGCCACTTTCACACGAAGTTATCTCGAGATAACTTCGTGTGAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-422s21c1
Sequence:CCGGACTGTCCTGGCCACGATATTTCTCGAGAAATATCGTGGCCAGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001415
EIF2S3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-1403s1c1
Sequence:CCGGGAGGAGTGACAATCAAGCCAACTCGAGTTGGCTTGATTGTCACTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1346s1c1
Sequence:CCGGCCCTTAGCCGAAGAGTTGAAACTCGAGTTTCAACTCTTCGGCTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-261s1c1
Sequence:CCGGGCTTGGATATGCTAATGCTAACTCGAGTTAGCATTAGCATATCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1215s1c1
Sequence:CCGGGTCTAAGAATGAAGTGCTCATCTCGAGATGAGCACTTCATTCTTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-782s1c1
Sequence:CCGGCCCGGCTTATTGTTATTAGATCTCGAGATCTAATAACAATAAGCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-646s1c1
Sequence:CCGGGCATTTGTCCAAGGTACAGTACTCGAGTACTGTACCTTGGACAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001415.2-1225s1c1
Sequence:CCGGGAAGTGCTCATGGTGAACATACTCGAGTATGTTCACCATGAGCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-824s1c1
Sequence:CCGGGCTGTGAAGTTGATGACCTTACTCGAGTAAGGTCATCAACTTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001415.2-989s1c1
Sequence:CCGGCGGAGCATAATGATCTGCAATCTCGAGATTGCAGATCATTATGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-1435s21c1
Sequence:CCGGGACTGAAGAATACCAGTTAAACTCGAGTTTAACTGGTATTCTTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001415.3-1558s21c1
Sequence:CCGGGTAGGTAACGGTAAGGTTATTCTCGAGAATAACCTTACCGTTACCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-646s21c1
Sequence:CCGGGCATTTGTCCAAGGTACAGTACTCGAGTACTGTACCTTGGACAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-108s21c1
Sequence:CCGGGCCACTTTCACACGAAGTTATCTCGAGATAACTTCGTGTGAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001415.3-422s21c1
Sequence:CCGGACTGTCCTGGCCACGATATTTCTCGAGAAATATCGTGGCCAGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)