EMAIL THIS PAGE TO A FRIEND

EIF3A

eukaryotic translation initiation factor 3, subunit A

134 Gene Product Result for
Synonyms: EIF3 EIF3S10 P167 TIF32 eIF3-p170 eIF3-theta p180 p185
UniProtKB ID: Q14152, B1AMV5, O00653, Q15778
Gene ID:
Mouse(13669) eukaryotic translation initiation factor 3, subunit A
Rat(292148) eukaryotic translation initiation factor 3, subunit A
Zebrafish(100334544) eukaryotic translation initiation factor 3, subunit A
Thale Cress(826746) eukaryotic translation initiation factor 3A
cow(506564) eukaryotic translation initiation factor 3, subunit A
Horse(100066047) eukaryotic translation initiation factor 3, subunit A
domestic cat(101093716) eukaryotic translation initiation factor 3, subunit A
dog(486914) eukaryotic translation initiation factor 3, subunit A
chicken(423927) eukaryotic translation initiation factor 3, subunit A
domestic guinea pig(100717430) eukaryotic translation initiation factor 3, subunit A
naked mole-rat(101720840) eukaryotic translation initiation factor 3, subunit A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003750 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029801 MISSION® esiRNA esiRNA human EIF3S10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003750 Rosetta Predictions human pricing
NM_001047087 Rosetta Predictions rat pricing
NM_010123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149898 predicted 1891
2 SASI_Hs01_00149900 predicted 735
3 SASI_Hs01_00149901 predicted 4231
4 SASI_Hs01_00149903 predicted 856
5 SASI_Hs01_00149904 predicted 1589
6 SASI_Hs02_00336216 predicted 2479
7 SASI_Hs01_00149905 predicted 3480
8 SASI_Hs02_00336217 predicted 725
9 SASI_Hs01_00149906 predicted 2980
10 SASI_Hs01_00149907 predicted 1019
11 SASI_Hs01_00149899 predicted 483
12 SASI_Hs01_00149902 predicted 2765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205804 predicted 966
2 SASI_Rn02_00205805 predicted 1324
3 SASI_Rn02_00205806 predicted 1876
4 SASI_Rn02_00205807 predicted 545
5 SASI_Rn02_00205808 predicted 3111
6 SASI_Rn02_00205809 predicted 1272
7 SASI_Rn02_00205810 predicted 2359
8 SASI_Rn02_00205811 predicted 304
9 SASI_Rn02_00205812 predicted 835
10 SASI_Rn02_00205813 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317842 predicted 888
2 SASI_Mm01_00042126 predicted 375
3 SASI_Mm02_00317843 predicted 312
4 SASI_Mm01_00042129 predicted 493
5 SASI_Mm01_00042130 predicted 2700
6 SASI_Mm01_00042131 predicted 645
7 SASI_Mm01_00042132 predicted 1277
8 SASI_Mm02_00317844 predicted 1824
9 SASI_Mm01_00042133 predicted 430
10 SASI_Mm01_00042134 predicted 1047
11 SASI_Mm01_00042125 predicted 1105
12 SASI_Mm01_00042127 predicted 714
13 SASI_Mm01_00042128 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003750
VALIDATED
EIF3A MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-408s21c1
Sequence:CCGGGATGTTGTTAGGGCATATTTGCTCGAGCAAATATGCCCTAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003750.2-4663s21c1
Sequence:CCGGGAATGAAGTAAGGTTCTGTTACTCGAGTAACAGAACCTTACTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-1886s21c1
Sequence:CCGGGCGCCTTGAGAGTCTGAATATCTCGAGATATTCAGACTCTCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003750.2-1241s21c1
Sequence:CCGGGACACGAATTGGCCTTATTAACTCGAGTTAATAAGGCCAATTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-1025s21c1
Sequence:CCGGATCTACACTCCATCGTCTTTACTCGAGTAAAGACGATGGAGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-3597s21c1
Sequence:CCGGCGTGCTGATGATGATCGGTTTCTCGAGAAACCGATCATCATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003750.1-4629s1c1
Sequence:CCGGGAATGAAGTAAGGTTCTGTTACTCGAGTAACAGAACCTTACTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003750.1-3564s1c1
Sequence:CCGGCGTGCTGATGATGATCGGTTTCTCGAGAAACCGATCATCATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003750.1-1207s1c1
Sequence:CCGGCGACACGAATTGGCCTTATTACTCGAGTAATAAGGCCAATTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003750.1-1853s1c1
Sequence:CCGGGCGCCTTGAGAGTCTGAATATCTCGAGATATTCAGACTCTCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003750.1-156s1c1
Sequence:CCGGGCCAACGAATTTCTTGAGGTTCTCGAGAACCTCAAGAAATTCGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003750
VALIDATED
EIF3A MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-408s21c1
Sequence:CCGGGATGTTGTTAGGGCATATTTGCTCGAGCAAATATGCCCTAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003750.2-4663s21c1
Sequence:CCGGGAATGAAGTAAGGTTCTGTTACTCGAGTAACAGAACCTTACTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-1886s21c1
Sequence:CCGGGCGCCTTGAGAGTCTGAATATCTCGAGATATTCAGACTCTCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003750.2-1241s21c1
Sequence:CCGGGACACGAATTGGCCTTATTAACTCGAGTTAATAAGGCCAATTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-1025s21c1
Sequence:CCGGATCTACACTCCATCGTCTTTACTCGAGTAAAGACGATGGAGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-3597s21c1
Sequence:CCGGCGTGCTGATGATGATCGGTTTCTCGAGAAACCGATCATCATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003750.1-4629s1c1
Sequence:CCGGGAATGAAGTAAGGTTCTGTTACTCGAGTAACAGAACCTTACTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003750.1-3564s1c1
Sequence:CCGGCGTGCTGATGATGATCGGTTTCTCGAGAAACCGATCATCATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003750.1-1207s1c1
Sequence:CCGGCGACACGAATTGGCCTTATTACTCGAGTAATAAGGCCAATTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003750.1-1853s1c1
Sequence:CCGGGCGCCTTGAGAGTCTGAATATCTCGAGATATTCAGACTCTCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003750.1-156s1c1
Sequence:CCGGGCCAACGAATTTCTTGAGGTTCTCGAGAACCTCAAGAAATTCGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003750
VALIDATED
EIF3A MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-408s21c1
Sequence:CCGGGATGTTGTTAGGGCATATTTGCTCGAGCAAATATGCCCTAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003750.2-4663s21c1
Sequence:CCGGGAATGAAGTAAGGTTCTGTTACTCGAGTAACAGAACCTTACTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-1886s21c1
Sequence:CCGGGCGCCTTGAGAGTCTGAATATCTCGAGATATTCAGACTCTCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003750.2-1241s21c1
Sequence:CCGGGACACGAATTGGCCTTATTAACTCGAGTTAATAAGGCCAATTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-1025s21c1
Sequence:CCGGATCTACACTCCATCGTCTTTACTCGAGTAAAGACGATGGAGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003750.2-3597s21c1
Sequence:CCGGCGTGCTGATGATGATCGGTTTCTCGAGAAACCGATCATCATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003750.1-4629s1c1
Sequence:CCGGGAATGAAGTAAGGTTCTGTTACTCGAGTAACAGAACCTTACTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003750.1-3564s1c1
Sequence:CCGGCGTGCTGATGATGATCGGTTTCTCGAGAAACCGATCATCATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003750.1-1207s1c1
Sequence:CCGGCGACACGAATTGGCCTTATTACTCGAGTAATAAGGCCAATTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003750.1-1853s1c1
Sequence:CCGGGCGCCTTGAGAGTCTGAATATCTCGAGATATTCAGACTCTCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003750.1-156s1c1
Sequence:CCGGGCCAACGAATTTCTTGAGGTTCTCGAGAACCTCAAGAAATTCGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010123
VALIDATED
EIF3A MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010123.3-4254s21c1
Sequence:CCGGGATCACATTCAAGGATTATTACTCGAGTAATAATCCTTGAATGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-1200s21c1
Sequence:CCGGTTGGATATGGATGGTATTATACTCGAGTATAATACCATCCATATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-2715s21c1
Sequence:CCGGCGAGTCAAGAAACTAGAAGAACTCGAGTTCTTCTAGTTTCTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010123.3-980s21c1
Sequence:CCGGGCCTCAGTTGATGGCAAATTACTCGAGTAATTTGCCATCAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-764s21c1
Sequence:CCGGGCTATGTGACAACTTGCGAATCTCGAGATTCGCAAGTTGTCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010123.2-4849s1c1
Sequence:CCGGCCACTAATTCATGCCTTTCAACTCGAGTTGAAAGGCATGAATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-714s1c1
Sequence:CCGGGCTATGTGACAACTTGCGAATCTCGAGATTCGCAAGTTGTCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-3952s1c1
Sequence:CCGGCGCACTGATGACAGGAAAGATCTCGAGATCTTTCCTGTCATCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-930s1c1
Sequence:CCGGGCCTCAGTTGATGGCAAATTACTCGAGTAATTTGCCATCAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-2665s1c1
Sequence:CCGGCGAGTCAAGAAACTAGAAGAACTCGAGTTCTTCTAGTTTCTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010123
VALIDATED
EIF3A MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010123.3-4254s21c1
Sequence:CCGGGATCACATTCAAGGATTATTACTCGAGTAATAATCCTTGAATGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-1200s21c1
Sequence:CCGGTTGGATATGGATGGTATTATACTCGAGTATAATACCATCCATATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-2715s21c1
Sequence:CCGGCGAGTCAAGAAACTAGAAGAACTCGAGTTCTTCTAGTTTCTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010123.3-980s21c1
Sequence:CCGGGCCTCAGTTGATGGCAAATTACTCGAGTAATTTGCCATCAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-764s21c1
Sequence:CCGGGCTATGTGACAACTTGCGAATCTCGAGATTCGCAAGTTGTCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010123.2-4849s1c1
Sequence:CCGGCCACTAATTCATGCCTTTCAACTCGAGTTGAAAGGCATGAATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-714s1c1
Sequence:CCGGGCTATGTGACAACTTGCGAATCTCGAGATTCGCAAGTTGTCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-3952s1c1
Sequence:CCGGCGCACTGATGACAGGAAAGATCTCGAGATCTTTCCTGTCATCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-930s1c1
Sequence:CCGGGCCTCAGTTGATGGCAAATTACTCGAGTAATTTGCCATCAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-2665s1c1
Sequence:CCGGCGAGTCAAGAAACTAGAAGAACTCGAGTTCTTCTAGTTTCTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010123
VALIDATED
EIF3A MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010123.3-4254s21c1
Sequence:CCGGGATCACATTCAAGGATTATTACTCGAGTAATAATCCTTGAATGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-1200s21c1
Sequence:CCGGTTGGATATGGATGGTATTATACTCGAGTATAATACCATCCATATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-2715s21c1
Sequence:CCGGCGAGTCAAGAAACTAGAAGAACTCGAGTTCTTCTAGTTTCTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010123.3-980s21c1
Sequence:CCGGGCCTCAGTTGATGGCAAATTACTCGAGTAATTTGCCATCAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010123.3-764s21c1
Sequence:CCGGGCTATGTGACAACTTGCGAATCTCGAGATTCGCAAGTTGTCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010123.2-4849s1c1
Sequence:CCGGCCACTAATTCATGCCTTTCAACTCGAGTTGAAAGGCATGAATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-714s1c1
Sequence:CCGGGCTATGTGACAACTTGCGAATCTCGAGATTCGCAAGTTGTCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-3952s1c1
Sequence:CCGGCGCACTGATGACAGGAAAGATCTCGAGATCTTTCCTGTCATCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-930s1c1
Sequence:CCGGGCCTCAGTTGATGGCAAATTACTCGAGTAATTTGCCATCAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010123.2-2665s1c1
Sequence:CCGGCGAGTCAAGAAACTAGAAGAACTCGAGTTCTTCTAGTTTCTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks